eChapters

23.1 Introduction

Excretion is the elimination of nitrogenous metabolic wastes from the gut and skin of the body. Through excretion, certain substances are removed while others are conserved. Fish are either ammonotelic or ureotelic animals. Kidneys play the most important role in excretion to maintain water-salt balance.

Fish gill ammonia excretion has been investigated for 80 years, but its mechanisms are still up for debate. A new paradigm has been established by the relatively recent identification of the ammonia-transporting role of the Rhesus (Rh) proteins, a family related to the Mep/Amt family of methyl ammonia and ammonia transporters in many living organisms. These proteins also occur as glycosylated proteins in fish gills (Wright and Wood, 2009).

30.1 Introduction

Sexual dimorphism is a condition in which sexes of the same species exhibit morphological differences that are not directly related to reproduction. It is a common and noticeable feature of the animal world. It is extremely important in biodiversity assessments, as well as in biometry, breeding biology, induced breeding, breeding, pheromone biology and other related fields.

38.1 Introduction

To fishery management, understanding the abundance of a given species population is critical to the success of that species’ fishery. In this context, a fish population is a naturally occurring stock of a race of fish that occupy a specific area of space and act as a biological unit. The density of the fish population, on the other hand, is the population size per unit of space.

40.1 Introduction

India has an 8,118-kilometer-long coastline that stretches through nine Maritime States (Gujarat, Tamil Nadu, Kerala, West Bengal, Maharashtra, Odisha, Andhra Pradesh, Karnataka, and Goa) and four Union Territories (Daman and Diu, Puducherry, Lakshadweep Islands, and Andaman and Nicobar Islands). The country also has a Continental Shelf of 0.53 million km2 and an Exclusive Economic Zone (EEZ) of 2.02 million km2. The EEZ’s annual potential yield is estimated to be 3.93 million tonnes of fish.

45.1 Introduction

Mosquitoes of various species breed in ponds, swamps, gutters, and other bodies of stagnant water, carrying parasites that cause malaria, filaria, dengue fever, chikungunya, Japanese encephalitis, Zika and yellow fever. Various approaches have been used to control mosquito populations to reduce the incidence of vector borne diseases, including chemical, physical, and biological measures. In all types of habitats, biological control against mosquito vectors is safe, friendly, and cost effective. Mosquito biological control entails introducing natural enemies such as parasites, disease organisms, and predatory animals into the environment.

Information and Communication Technology: Concept

ICT refers to an extensive array of systems and technologies dedicated to managing and delivering information and facilitating communication. This includes digital platforms such as the internet and the World Wide Web, as well as traditional media like radio, television—through cable and wireless methods—mobile phones, and printed materials. Accompanying these technologies are services and applications such as videoconferencing and online learning that utilize these mediums.

Introduction

Impact studies isolate the effect of an intervention by assuring that there is clean comparison between a treatment group that received the intervention and a comparison group that is just the same except that it did not get the intervention.

Impact studies test whether one thing causes another. Just knowing scores have gone up following an intervention doesn’t mean improvement is attributable to that intervention.

The data are generated from an impact study used to identify best practices, to replicate successful programs or policies, and to avoid mistakes that might have negative implications for future projects.

India is primarily an agriculture based economy, which implies, agriculture dominates the nation’s economic landscape. In the course of socioeconomic growth, agriculture is crucial. Around 58 per cent of the population in India rely only on agriculture for their livelihood. In India, agriculture acts as an important source of living for about 60 per cent of the population (India Brand Equity Foundation, 2021) and almost 70 per cent of rural households depend on farming. The farming sector in India contributes significantly to the economy, making up about 29 per cent of Gross Domestic Product (GDP) (Balkrishna et al. 2021).

Introduction

Forest restoration is a complex process that requires many steps to ensure successful forest establishment. These steps include choosing suitable tree species and provenances, applying nursery cultural practices to produce quality seedlings and making site modifications to improve the physical environment of the restoration site (Grassnickle, 2000). Conifers are the most important tree species of the western Himalayas and J&K. There are about 16 species spread over 9 genera in 3 families. Among these families, Pinaceae, with seven species in 4 genera, is the most dominant, while Taxodiaceae, with 2 species in 2 genera, is the least represented. Out of the total taxa, 7 species belonging to 5 genera are exotic and exist in cultivation only.

Conifers are valuable natural resources of the country, which contribute substantially to its socio-economic development by providing goods and services to the people and industry. They generate considerable revenue and also play a major role in enhancing the quality of the environment by influencing the basic life support system. Unfortunately, however, they have been subjected to over- exploitation and biotic pressure in the last many years, thereby threatening the very existence of some species such as yew, chilgoza pine etc. The genus Pinus is, in fact, one of the largest and most divergent of the coniferous genera, comprising about 95 species and numerous other varieties and hybrids. They are distributed widely in the northern hemisphere, chiefly in the temperate and cold climates.

Introduction

A forest is a complex ecosystem, predominantly composed of trees and shrubs, which usually form a closed canopy. They form a storehouse of a large variety of life forms such as plants, mammals, birds, insects, reptiles etc., besides being the most important habitat of the microorganisms and fungi, which do the important work of decomposing dead organic matter, thereby enriching the soil. Nearly 4 billion hectares of forests cover the earth’s surface, roughly 30% of its total land area. The forest ecosystem has two components- abiotic and biotic. Climate and soil type form a part of the non-living component and the living component includes plants, animals and other life forms. Plants include the trees, shrubs, climbers, grasses and herbs in the forest.

Soil-borne plant pathogens cause significant losses in the nursery plantation of agricultural, horticultural and forestry plantation stands. These pathogens can survive in the soil for many years through their resistant structures. Besides, the diseases caused by them are difficult to predict. Soil factors like soil type, texture, pH, moisture, temperature, level of organic matter and nutrient content influence the activity of soil-borne pathogens and diseases. In order to survive successfully, these pathogens compete with others for nutrition, space and other requirements. Understanding the dynamics of these pathogens and other microbial populations in the soil in relation to environmental conditions is essential for the successful management of these diseases.

The management of diseases and pests is a major challenge. Monoculture, excess use of fertilisers, high- yielding varieties, climate change etc have not only intensified plant diseases, but also given rise to new diseases or intensified those diseases which were earlier considered of minor importance. Although decades of research have given rise to certain promising organic and biological alternatives to chemical disease management, due to the lack of proper attention of researchers worldwide, the organic and biological disease management technologies are still not very popular.

Catheterization is done for both diagnostic as well as therapeutic purpose. As a diagnostic technique it is employed to collect urine samples, prostatic wash and suction biopsy. As a therapeutic technique it is used for the treatment of urine retention, obstruction and for monitoring urine output. Pneumocystography is a contrast radiography. It is being employed to distinguish the urinary bladder from other organs and to visualize the details of the bladder.

Catheterization

An appropriate catheter needs to be selected as per the requirement (purpose of catheterization and duration of catheterization). A soft, silicone flexible catheter is appropriate for indwelling purpose. Whereas a rigid catheter is more desirable to unblock a small calculi and collecting samples for diagnostic purpose. Small size catheters are best in order to minimize urethral trauma.

It is an easy, non-invasive, bed side technique for continuous monitoring the saturation of oxygen bound to hemoglobin (SpO2). The technique was invented by Dr. Takuo Aoyagi in 1974 to measure oxygen saturation in the blood. During recent years it has shown great utility in patient care. The oxygen saturation of hemoglobin provides a measure of cardio-respiratory functioning. Pulse oximeters generally used in humans are not appropriate for the use in dogs and cats as these are designed to apply on fingers and programmed with the oxygen hemoglobin dissociation curve for humans.

Indications

Pulse oximetry is an important standard technique of patient care in cases of heart failure, respiratory failure, multiple organ failure, critical care, emergency, accident and during anesthesia.

Electrocardiography-A noninvasive Technique

Electrocardiography is a non-invasive diagnostic technique routinely used to examine the electrical activity of the heart in health and diseases. It is an important tool for the clinical evaluation of the heart. The technique provides important information regarding heart rate, heart rhythm, impulse formation and its conduction. Heart size can also be assessed to some extent in humans and dogs. The process of electrocardiography leads to generation of an electrocardiogram as a consequence of depolarization and repolarization of heart muscle cells during each heartbeat.

Pesticide Authorities

Central Insecticides Board and Registration Committee

In India, the central pesticide board and registration committee oversee the import, production, sale, transportation, distribution, and use of insecticides. Pesticides in India are regulated by the following two government organisations Central Insecticides Board and Registration Committee CIBRC and Food Safety and Standards Authority of India (FSSAI ).

Central Insecticide Board (CIB)

• The Central Insecticides Board advises the central and state governments on technical issues arising from the administration of this act, as well as carrying out the other tasks given to it by or under this act.

Mouthparts of insects vary among insects of different groups depending upon their feeding habits. They are mainly of two types viz., Mandibulate (feeding mainly on solid food) and haustellate (feeding mainly on liquid food). Insect mouthparts have become modified in various groups to perform the ingestion of different types of food and by different methods. Indeed the modifications in the mouthparts to ingest almost all kinds of the food material, are one of the factors for the success of the group.

1. Biting and chewing type: e.g. Cockroach & grasshopper.

The typical thoracic leg consists of six parts, basal coxa that articulates with the thorax in the pleural region, small trochanter, femur, tibia, segmented tarsus, and pre-tarsus. The coxa is often divided into two parts, the posterior and the anterior (usually the larger part) being called the meron. The trochanter articulates with the coxa but usually forms an immovable attachment with the femur. The femur and tibia are typically the longest leg segments. The tarsus, which is derived from a single segment, - is usually subdivided into individual tarsomeres. The pretarsus may consist of a single claw, but it is usually composed of a pair of moveable claws and one or more pads or bristles. Legs are usually looked upon as the principal organs of terrestrial locomotion.

The complete system of veins of a wing is termed venation or neuration. Generally in all the insects, there is some similarity in wing venation and therefore, it is presumed that all types of wing venation have developed from the common base or the same ancestor. Using an extensive study of wing venation in different groups of insects, Comstock and Needham constructed a hypothetical type of wing venation from which all other types have presumably been derived. According to them the primitive wing venation has developed from two tracheae which are situated on the anterior and the posterior basal margins of wings and their branches are spread all over the wing.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

Introduction

Citrus fruits are acidic, exotic fruits with juicy, bitter, fruit segments inside. Citrus fruits commonly originated in tropical and sub-tropical regions of the world. They have long been valued as part of a nutritious and tasty diet. The f lavours provided by citrus are among the most preferred in the world, and it is increasingly evident that citrus not only tastes good, but is also good for people. Citrus fruits have certain therapeutic properties such as antitumor, anti-inflammatory and anticancer, due to phytovitamins and nutrients present in them.

U value: U value is a measure of the heat transmission through a building part (wall or window) or through a given thickness of a material (insulation). U values with lower numbers indicate better insulating properties.

Ubiquinone: It is one of the groups of lipid soluble quinones that are found especially in mitochondria and have a long isoprenoid side chain, and function in oxidative phosphorylation as electron carrying coenzymes in electron transport.

UHT milk: This milk is homogenized, heated to atleast 135oC for about 2-3 second, cooled rapidly and then packed in sterilized containers aseptically. The milk in packs can be stored for several months with out refrigeration. The nutrient loss is negligible. Used for making yogurt commercially as it does not need to be boiled again.

UHT pasteurization: The milk is heated to ~150oC for a fraction of seconds practically no holding period. It is also called ultra pasteurization.

UHT sterilization: It is method in which food is sterilized, cooled and then aseptically placed in previously sterilized containers which are subsequently sealed in an aseptic environment.

Ulcer: A break in skin or mucous membrane with loss of surface tissue, disintegration and necrosis of epithelial tissue (often with pus). It is something that festers and corrupts like an open sore.

Ulcerate: A tissue or skin thatbecomes affected with an ulcer is called ulcerate.

Ulceration: The process of becoming a tissue or skin ulcerated is called ulceration.

Brainstorming is a group creativity technique by which efforts are made to find a conclusion for a specific problem by gathering a list of ideas spontaneously contributed by its members. The term was popularized by Alex Faickney Osborn in the 1953 book Applied Imagination. Osborn claimed that brainstorming was more effective than individuals working alone in generating ideas, although more recent research has questioned this conclusion. Today, the term is used as a catch all for all group ideation sessions.

Origin

Advertising executive Alex F. Osborn began developing methods for creative problem solving in 1939. He was frustrated by employees’ inability to develop creative ideas individually for ad campaigns. In response, he began hosting group-thinking sessions and discovered a significant improvement in the quality and quantity of ideas produced by employees.

15.1 Introduction

Curry leaf is an important perennial tree vegetable cum spice crop of India mostly used in South Indian culinary preparations for flavouring food stuff. It is an under exploited crop. The leaves have slightly pungent, bitter and feebly acidic taste and they retain their flavour and other qualities even after drying. Curry leaf is used in many of the Indian Ayurvedic and Unani prescriptions. It has many industrial values and medicinal uses. Its leaves, roots and bark are credited with tonic, stomachic and carminative properties. Leaves are reported to cure piles and allay heat of body. The green leaves are said to be eaten raw for treatment of dysentery. External application of pulped bark and root is reported to relive eruptions and bites of poisonous animals. An injection of toasted leaves is used to stop vomiting. The tribal people of India use its ground bark to rub on the bitten Part As a snake bite remedy. The powdered leaves are also used to aid in healing of fresh cuts. The dried curry leaf powder is also a good spice powder for use in the food stuff preparation and is exported. Fresh leaves on a steam distillation under high pressure yield 2.6 % (curry leaf oil) volatile oil which is used as fixative for heavy type of soap and perfume. Rectified leaf oil is deep yellow in colour with a strong spicy odour and pungent clove like taste. A volatile oil, a crystalline glucoside ‘Koenigin’ from the leaves and ‘Murayam’ from the flowers are industrial products. Curry leaf is grown on large scale in West Bengal, Assam, Deccan plateau, Western Ghats, Tamil Nadu, Karnataka and Kerala. It is cultivated in Coimbatore, Salem and Tiruchirappalli districts of Tamil Nadu on a commercial scale.

16.1 Introduction

Portulaca is an annual potherb, but may be perennial in the tropics. In many parts of the world, it is still regarded as a weed with nutritional potential. Its young stems and leaves are succulent and edible with a slightly acidic and salty taste. Stems are glabrous, fleshy, purplish-red to green, arising from a taproot, often prostrate, forming mats. It is described as a power food of the future because of its high nutritive and antioxidant properties. It contains more omega-3 fatty acids (300 to 400 mg/100 g of fresh leaves) than any other leafy vegetable plant. Succulent leaves and stem also contain dietary minerals, such as calcium, phosphorus, iron and potassium, as well as vitamins A, C and E and some amount of vitamin B and carotenoids. It has been recommended as a cholesterol lowering agent and as a therapy for arteriosclerosis. Generally, roots and leaves contain more iron and manganese than stems. Due to oxalic acid and nitrate content, excessive consumption of purslane is not recommended. The cultivated form of Purslane, i.e., Portulaca oleracea (garden or green purslane) and Portulaca sativa (yellow leaves, less hardy than the green purslane but possessing the same qualities), is hexaploid. Purslane is a succulent and well-branched herb, leaves are spirally arranged, flowers are yellow, stamens 7-10, style with arms, fruit ovoid, capsule, seeds numerous, tiny and black in colour.

Introduction

An integrated approach to understanding the changing dynamics in water resources involves taking into account various factors that influence the management of water resources under changing climatic conditions (Pahl-Wostl, 2007). It is a holistic approach that combines different disciplines, including hydrology, climatology, ecology, geography, and social sciences, to develop a comprehensive understanding of water resources. The integrated approach is essential for several reasons, including addressing climate change impacts, sustainable management of water resources, enhancing water security, addressing water quality issues, and promoting collaboration among stakeholders. Climate change is causing alterations in precipitation patterns, melting glaciers, and changes in river flows, affecting water availability and quality. An integrated approach helps in understanding the climate change impacts on water resources and developing adaptation strategies (Asif et al., 2023).

Introduction

After harvesting of crop, a huge or less amount of residues get produced from crop fields. Crop residue is the most reachable and ready to serve form of biomass. For agricultural lands, to improve soil quality, crop derived residue is considered as “the greatest source of soil organic matter” (Tisdale et al., 1985). But for farmers, the easiest way to get rid of this residue is on farm burning of it. This type of residue management practices not only give rise to fire hazards and one of the main source of atmospheric pollution but also lead to loss of nutrients and organic matter from soil. The Ministry of New and Renewable Energy, reported that almost five hundred M tons of crop remains is produced every year from India. It has also been reported that a major part of these crops remains is being used in the form of fodder, forage and other industrial purposes. In India, farmers burn their crop residue for feasible management of it, although it costs a lot to our soils. It is estimated that various crops residue contains around 80 percent of Nitrogen, 25 percent of Phosphorus, 50 percent of Sulphur and nearly 20 percent of Potassium and thus, crop residue burning causes loss of these nutrients. The burning of the one tonne of residue leads to loss of 5.5 Kg Nitrogen, 2.3 Kg phosphorus, 25 Kg potassium and 1.2 Kg sulphur, along with the nutrient loss, burning also hampers organic carbon in soil as well as increase in greenhouse gas emission. It also leads to climate change. In agriculture, loss of nutrients from soil depends on the crop which is burned. Sugarcane trash is responsible for maximum nutrient loss followed by rice and wheat straw.

This chapter describes fundamental terminology and lays the foundational framework for the course. It offers a general understanding of statistics, its purpose, and its role in addressing diverse problems across various fields of study. Additionally, it explains the rationale behind choosing R software as a powerful tool for data analysis.

Basic Concepts and Terminology

Statistics is an essential tool in agriculture, helping researchers to collect, analyze, interpret, and present numerical data related to plant traits, and agricultural practices. The fundamental goal is to make informed decisions and enhance crop yields, quality, and resilience.

To illustrate, researchers choose to work with a sample due to practical considerations, such as time and cost constraints. For instance, in a field with 10,000 crop plants, a researcher aims to determine the average plant height in the field. To conserve time and resources, they randomly select 200 plants from various locations within the field. These 200 plants constitute a sample from the entire population of 10,000 plants. By analyzing the height observed in the sample, the researcher can conclude the average height of the entire crop field.

This chapter begins by providing an essential overview of different data transformation methods and their importance. It primarily concentrates on exploring three crucial transformation techniques: the square root transformation, log transformation, and arc sine transformation. Additionally, this chapter explores the practical application and analysis of these transformations using the R programming language.

Data Transformation

Data transformation is often needed in statistical analysis and data processing for several key reasons:

• Assumption of homogeneity of variances: ANOVA requires that the variances within each group being compared are equal. When this assumption is violated, i.e., when variances are significantly different across groups, data transformation can help stabilize these variances.

• Normality assumption: ANOVA assumes that the residuals (the differences between observed and predicted values) are normally distributed. However, real-world data often deviates from this normal distribution. Data transformation, such as log or square root transformations, can help in reshaping the distribution of data.

• Handling skewed data: In situations where the data is highly skewed, the results of ANOVA can be misleading. Transformations can reduce skewness, making the distribution more symmetric and suitable for ANOVA.

• Proportional or percentage data: When dealing with data in the form of proportions or percentages, certain transformations (like the arc sine transformation) are necessary. This is because proportions have a bounded scale (0–1 or 0–100%) and their variances are not constant across the range, which can violate ANOVA assumptions

In this chapter, we explore Latin square design (LSD), a specialized form of experimental design renowned for its efficiency in controlling variation. This chapter thoroughly discovers the foundational principles, structure, and application of LSD in experimental research. It details mathematical models for LSD and guides readers through the interpretation of ANOVA tables. Furthermore, the chapter provides a systematic approach to conducting LSD analysis using R software.

Latin Square Design

The LSD is a statistical design used extensively in experiments, especially when specific conditions are met:

• Controlled variation in two directions: LSD is particularly suited for experiments where variation can be controlled along two different factors. This design structures the experimental units into a square matrix, allowing two sources of variability to be accounted for.

• Adherence to experimental design principles: Like other designs, LSD follows the key principles of randomization, replication, and local control. Randomization in LSD is applied within the rows and columns of the square matrix, ensuring unbiased treatment comparisons.

• Efficient use of resources: LSD allows for an effective utilization of resources by controlling two variables simultaneously. This makes it a more efficient design compared to RBD or CRD when there are two sources of nuisance variables.

3.1 Introduction

To remove the inequality in technology development and its use, the concept Gender and technology arises. Economic resources should be equally distributed among the men and women. Technology can also help challenge and break gender stereotypes and biases that often limit women's potential. First of all, much equipment tends to be gender-typed. There are machines and tools suitable" for men as saws, trucks, wrenches, guns and forklifts. Some other technologies are "suitable" for women as vacuum cleaners, typewriters and food processors. The main focus of year 2023 is on innovation and technology for gender equality. Innovation and technological change are deep shifts reshaping life in the twenty-first century. Technological progress allows for unprecedented advances with the potential to improve social, economic and political outcomes for all.

Seed is the primary and most critical input in any crop production programme. A quality seed alone contributes around 15-20% towards total production. The efficacy of all other inputs to increase production will be in vain if the quality of the seed is poor. Hence, use of quality seed is crucial as it appreciably increase the productivity of the crop without depending much on other inputs. This adds to the old saying in Manu Smriti good seed in good field yield abundantly .A quality seed can be defined as genetically and physically pure seeds with high germination percentage, free from seed borne pathogens and safe moisture content. This guarantees good germination, vigorous growth, and good establishment of crop in the field.

History of Seed Industry in India

Farmers dependent mostly on traditional indigenous varieties earlier and its seed requirements were met through their own farm saved seeds or through local sources. But the quality of these seed stocks was not assured, and this resulted in drastic reduction in production as well as productivity of the crops. As a result of various crop improvement programmes, improved varieties possessing high yield potential along with additional characters of biotic and abiotic resistance came into the scenario. But the availability of the seeds of these improved varieties among the farmers remained as a problem and it limited the cultivation of these varieties. This led to the development of a well-planned systemized seed production system. Government of India had framed and brought out different legislations for regulating systemized seed production. These laws are framed to make available quality seeds and planting materials to a common farmer and equip him to approach authority for justice. Seed legislations were initiated in the country by establishment of National Seed Corporation (NSC) during 1963 under Ministry of Agriculture and the seed industry was restructured through the nationals seed projects phase I (1977-78), Phase II (1978-79) and Phase III (1990-1991). These initiatives strengthened the seed industry through formulation of seed regulations, establishment of state seed corporations and seed certification agencies thereby assured the supply of quality seeds to farmers

Introduction

Women make essential contributions to the agricultural and rural economies in all developing countries. Their roles vary considerably between and within regions and are changing rapidly in many parts of the world, where economic and social forces are transforming the agricultural sector. Agriculture needs manpower, if the manpower split into gender wise, amazing fact is that the women contribution is greater or equal to men (Chauhan, 2011).That is reason that right from the day the country become independent, it has been trying hard for rural development.

According to the Penguin Atlas of Women in the World, women make up 40 per cent of the agricultural labour force in most parts of the world, while in developing countries they make up 67 per cent of the agricultural workforce (Singh, 2008). Therefore, strengthening and expanding women’s roles and opportunities in agriculture promotes sustainable economic development. Gender inequalities are a measurable and significant limit on agricultural productivity and efficiency, undermining rural economic development. India has paved the way to development by increasing its trade and growth in Agriculture sector. To review the agriculture scenario of our country, it depicted that there is need to pay sincere attention towards the human resource development (men and women together) because modernizing agriculture needs skill and efficient work forced. Farm business has become a family enterprise in India, where both men and women take part evenly. It is well known fact that the success of rural development process largely depends on the participation of people at large, irrespective of sex. The problems of involving women’s participation in the development process are now catching the attention of planners and policy maker because of increasing imbalances generated out of development process. Now days, rural women play a vital role in domestic and socio-economic life of the society and therefore, national development is not possible without developing this important and substantial section of our society (Okafor, 2008).

Introduction

Women play a pivotal role in agricultural and rural economies in all developing countries. Rural India woman is facing Poverty and unemployment is the major problems. In India at the end of ninth five year span 26.1% of the population was living below poverty line. In the rural area 27.1% of the population was living under poverty. The overall unemployment rate is estimated to 7.32%. The female unemployment rate is 8.5%. The rate of growth of women unemployment in the rural area is 9.8%. A series of development programmes have been implemented for the development of economy in general ignoring women who constitute 50 percent of the total population. Role of women in development is an indispensable factor. Development programmes no longer can achieve their target without the participation and contribution of women. Women empowerment is multifaceted concept that extends to the psychological, economic, social, cultural, political and institutional spheres of women’s lives. The Government of India has launched and implemented a number of schemes towards poverty alleviation and women empowerment but it was observed that women in rural areas especially from the poor families could not be benefitted. Women empowerment is the most important instrument for the socio-economic development of a nation. In this context, SHGs have emerged as the tools that wield power to create a socio-economic revolution in the rural areas of our country. The empowerment of rural women is a key priority in the National Development Policy of India. In India, the organization of SHGs, especially those promoted by Non Governmental organizations (NGOs) is widely recognized as a development strategy for poverty reduction. NGOs also known as voluntary sector have become an irresistible global force today and it is growing in relation to its presence in developmental activities. Basically, an NGO or voluntary organisations are non-profit making agencies that are constituted with a vision by a group of likeminded people, committed for the uplift of the poor, marginalized, unprivileged, underprivileged, impoverished, downtrodden and the needy and they are closer and accessible to the target groups, flexible in administration, quicker in decision making, timely in action and facilitating the people towards self reliance ensuring their fullest participation in the whole process of development. SHGs are started by NGOs that generally have broad anti-poverty agendas. SHGs are seen as instruments for goals including empowering women, developing leadership abilities among poor people, increasing school enrollments and improving nutrition and the use of birth control. SHGs are small group of individual members who voluntarily come together and form an association for achieving a common objective. In most cases, SHGs are constituted by persons known to one another and coming from the same village community or neighbourhood. SHGs are small in size with membership ranging from 10 to 20 and are homogeneous. A strengthening development among women the nation over has been currently turned by quick advancement in SHG arrangement. The arrangement of SHGs isn’t conclusively a miniaturized scale credit venture however a strengthening procedure. The strengthening of women through SHGs would give advantage not exclusively to the individual women yet in addition for the family and network all in all through aggregate activity for improvement. Women constitute half of any country’s human endowment. All round development and harmonious growth of a nation would be possible only when women are considered as equal partners in progress with men.

Introduction

Animal husbandry and poultry rearing, in addition to offering economic participation, play an important role in securing household food security. The core notion of food security argues that everyone should have physical and economic access to the basic nutrition they require. ‘Food security is a scenario that exists when all people have physical, social, and economic access to sufficient, secure, and nutritious food that fits their dietary needs and food preferences for an active and healthy life’, according to the FAO (2002). Consequently, two requirements must be met in order to ensure food security: the first is the availability of food, and the second is the ability to purchase it. There is a propensity to define food security at the national level without examining its condition at the grass roots level with major emphasis at the household or individual level. This is because, while national food security may appear to be adequate, disparities in food security may exist among regions, groups, households, and people.

Increased crop output can increase people’s calorific intake, but protein is also essential for health, and pulses and coarse grains are essential. According to the Directorate of Economics and Statistics, DAC & FW, total pulse output in the nation was roughly 25.42 million tonnes in 2017-18, and over 23.40 million tonnes in the following fiscal year (2018-19). This demonstrates the country’s falling pulse production pattern, diminishing the availability of vegetable protein to the public. A similar trend was observed in states like Assam, where the area under pulse production declined from 1,54,706 hectares in 2017-18 to 1,50,229 hectares in 2018-19, and further fell to 1,43,962 hectares in 2019-20. The provisional data further forecasted the area to fall even further to 1,42,303 hectares in 2020-21. (Statistical Handbook of Assam, 2020 and 2021)

Introduction

Beekeeping is an environment friendly and agro-forestry based occupation that has established itself as an income generating activity and a commercial enterprise which not only promote agricultural and horticultural development but also contributes in upliftment of the rural economy of the country. Apiculture provides enormous potential for income generation, poverty alleviation and sustainable use of forest resources. Traditional beekeeping with Apisceranais widely practised by rural people in Uttarakhand who have inherited the tradition from their forefathers and maintain it till this day. The people in Uttarakhand have indigenous knowledge of beekeeping which is passed from one generation to another. In the hill area traditional hives are more suitable than modern hives. Modern beekeeping is infancy in the area, so people need to be encouraged to use modern bee hives for better management of colonies.

Uttarakhand is a land of variety of flora and fauna. Beekeeping forms an integral part of the small holder farming system and plays a significant role as a source of additional cash income in subsistence farming. There are around 2,50,000 beekeeping units in India out of which only 8,700 are in Uttarakhand accounting for about 2500 MT of honey production in 2016-17. Uttarakhand is extremely rich in Bee forage plants but the use of this rich resource is not being made properly (Tiwari, et al. 2010). Around 20.00 per cent of the Beekeepers in Uttarakhand do not use any medicine for the management of pest and diseases showing that the farmers are not much aware of the advance methods of beekeeping (Khan et al., 2007). Uttarakhand has huge potential for beekeeping due to plenty of flora and suitability of climate. Beekeeping is an ancient practice that is managed traditionally in Kumaon hills of Uttarakhand. Due to the traditional production system the productivity per hive is low in Uttarakhand. Therefore, it is Important to know about the constraintsfaced by the Beekeepers in practicing apiculture in Kumaon Hills of Uttarakhand.

Information and Communication Technologies can play a major role in bridging the agricultural developmental and regional divide in Maharashtra. Computer, internet, multimedia, CDs, TV, radio, mobile phone, WLL, satellite communication (ISRO's Agriculture Satellite), etc., can help to extend and communicate the knowledge and expertise from best experts and scholars to farmers and villagers who are in need of it. Success of ICT application depends upon its use in meeting local needs and demands of village community. ICT has been used by many to communicate knowledge and provide various services useful to the farmers. We give here briefly some initiative in using ICT for various farm and farmer related activities.

ICT Application for Agriculture development – Initiatives & Programs Virtual Academy for Semi-Arid Tropics (VASAT)

The VASAT is an initiative taken by International Crop Research Institute for Semi-Arid tropics (ICRISAT), for sharing knowledge and information in the CGIAR and NARES partners to enhance the capacity of vulnerable rural families, their MAHA-AGRINET and information intermediaries to cope with drought and desertification and practice improved agriculture and animal husbandry in the SAT of the world.

VASAT is at the initial stage of development, and has started developing content building partnership with various MAHA – AGRINET at international, national and regional / state level. It is going to use ICT in all its operations and proposes to develop hub and spokes model of Dr. Swami nation for Tamil Nadu rural areas. Its website contains an e-library, working documents, a research project database, an image library, meteorological data, IARC training material and other resources. VASAT has identified its partners at the national and international levels; and include Indian research institutions and councils, higher education institutions – both formal and open, corporate bodies, state government bodies and project groups, the Commonwealth of Learning, the International Water Management Institute, South Asia regional office and the International Livestock Research Institute in South Asia. This coalition shares information, knowledge and experiences related to climate literacy, drought preparedness, best practice in dry land agriculture and other issues through the network of the institutions. VASAT offers a compilation of training materials and is currently planning to design, develop and test ICT-based information exchange models, a learning objects repository and proposes to link rural communities and their Organizations with international and national centers of excellence and expertise to support local efforts in drought and desertification management.

Introduction

Entrepreneurial communication is an action intended to forge a relationship with the other party in order to affect their interest, attitude, and behavior. This is due to the fact that it is never done without considering how it would affect both qualitative and quantitative outcomes. A person can transmit or receive information about another person’s needs, wants, perceptions, knowledge, or emotional states through the act of communicating. In the context of entrepreneurship, communication refers to a set of procedures for exchanging knowledge and understandings between individuals who are engaged in a predetermined or novel situation.

Every interaction that takes place during communication involves a shift and is dynamic. Since it is dependent on interaction and a transaction between speakers, communication cannot be understood s a straightforward process of transmission. The planned actions and activities are not hindered because the emission and reception occur simultaneously, with h the transmitter acting as both a receiver and a transmitter. The process of sending and receiving signals as knowledge, feelings, emotions, skills, talents, attitudes, activities, etc. is known as entrepreneurial communication.

In terms of information sharing about events, situations, involvement, impact, adaptation, etc., it is built on interactions between business owners, educators, and educated youth.

7.1 Summary

The presentre search hadbeenconducted to study the Entrepreneurial communication and the process, factors and impactin Agricultural enterprise and allied sectors of selected block of West Bengal and in the end the comparison is made. The study had been conducted at villages Mitrapur from blocks Haringhata of West Bengal. A pilot study was conducted to understand the area, its people, institution, communication and extension system of these states.

An exhaustive list of respondents was prepared critically with the help of some villagers. From the list, 75 respondents from the village were selected for the study through Systematic Random sampling method.The primary data were collected with the help of structured interview schedule by following the personal interview method. The secondary data were collected from our departmental library, internet, Department of Agriculture, West Bengal, Bidhan Chandra Krishi Viswavidyalaya etc. for establishing the conceptual framework of the study.

The general objective of the study is to estimate and analyse the “Productivity, Income, Livelihood and Ecology: The resilience analysis in Argo ecosystem” and the specific objectives are

• To study the present statuses of 1. Income 2. Productivity 3. Livelihood and 4. Ecological resilience of the respondence under study in a selected locale.

• To estimate the intra and inter level interaction among and between the selected sets of variables to estimate the common point of the interaction of the ‘Y’ Protected characteristics.

• To generate micro sociological policy implication based on empirical evidence.

• To isolate factors impactions on ecological resilience.

Introduction

A concept focused on crop and livestock production with minimal environmental impact has emerged as a result of the paradigm shift in Indian agriculture from traditional to sustainable agriculture. This concept also supports the farm economy and helps farmers improve their tactics and quality of life. This has sparked farmers’ interest in learning traditional technology skills that draw on local knowledge that people have acquired from their ancestors to address issues in agriculture and activities associated with natural processes. Indigenous Technical Knowledge (ITK), which is a component of using natural products to address agricultural problems and integrate activities, has attracted interest since the concept of sustainable agriculture began to emerge in the Indian state of agriculture in the late 1980s. ITK is regional knowledge unique to a particular culture or community.

At the beginning of the 21st century, the world is facing a number of major global challenges. On the development side one of these challenges is the establishment of sustainability. In the context of agricultural development, a new agenda has been set to achieve the goals of producing and disseminating economically viable, socially acceptable and environmentally sound technologies that are geographically sound. , even local agricultural schools cannot teach such knowledge because of its size and diversity (Pereira, 1993).

Introduction

The key to the advancement of women belong to poor background is self-help groups. Members of society with greater social influence are women. The World Bank estimates that women make up 48.0% of the population in India. Women in India are impacted by a number of economic and social variables. They are essential to any economy. Men and women must be viewed as equal participants in development if a nation is to achieve overall success and positive growth. The nation’s economic growth and social advancement depend on the independence of women. Through collective participation for growth, the empowerment of women through SHGs will benefit not just the individual women but also the family and network as a whole.

Self- Help Groups

Self-Help Groups (SHGs) have developed in order to assist underprivileged women in obtaining services and resources like loans. In 1985, the idea of SHG was first introduced in India. Self-help Groups (SHGs) are informal associations of people who come together to find ways to improve their living conditions. SHGs help in improve the lives of the poor and marginalised segments of society. They also foster financial inclusion. The self-help groups play an important role in ruler women life.India’s Self Help Group movement has emerged as the world’s largest network of community-based organizations.Under this programme, banks were allowed to open savings accounts for Self-Help Groups (SHGs). This was started in the early nineties. Empowering women is crucial to the prosperity and development of the country.

Introduction

Agriculture denotes as the key development in the rise of sedentary human civilization, where by farming of domesticated species creates food surpluses that enables people to survive and showing them the way of earning. Thus our country is enhancing agro-based industries. Industrial agriculture based on large scale monoculture, which is dominated by agricultural output. Hence it is the dynamically economic improvement of our country with the help of agriculture basing on modern information technology. Information technology means the latest version of information facilities like computer, mass media and Internet. Information technology (IT) or Information communication technology (ICT) is a broad subject concerned with technology and other aspects of managing and processing information.

Information technology contributes much to agriculture and rural development. It facilitates rural activities and provides more comfortable and also saves the rural life with equivalent services to those in urban areas such as provision of distance education, tele-medicine, remote public services, remote entertainment etc. IT initiates new agricultural and rural business such as e-commerce, real estate business for satellite offices, rural tourism, and virtual corporation of small-scale farms. It also supports policy-making and evaluation on optimal farm production, disaster management, agro-environmental resource management etc using tools such as geographic information systems (GIS). It also helps in improving farm management and farming technologies by efficient farm management, risk effective information or knowledge transfer etc realizing competitive and sustainable farming with safe products.

Introduction

In Puducherry, the first KVK was founded in 1974. In the newly constructed districts and several larger districts, 106 additional KVKs will be established, bringing the total number of KVKs to 645. KVKs are approved for use by Agricultural Universities, ICAR Institutes, associated Government Departments, and Non-Governmental Organizations (NGOs) engaged in agriculture. The KVK initiative is fully funded by the Government of India. KVK, which is a crucial component of NARS, aims to evaluate location-specific technology modules in agricultural and related companies through technology assessment, refinement, and demonstrations. As a knowledge and resource centre for agricultural technology, KVKs have supported public, private, and non-profit sector efforts aimed at enhancing the district’s agricultural economy(1).

The KVK’s mandate has changed from vocational training to technology assessment and demonstration for its application and capacity building in a district in preparation for its growing contribution to NARES in India. Though technologies were developed at ICAR Research Centres or State Agricultural Universities, KVK carried out location-specific technology assessments, micro location refinements on farms with genuine problems, and final technology certification for widespread adoption by farmers(2).

Introduction

Agriculture is a major sector in Indian economy. It is one of the biggest production sector contributing more than 20 percent of GDP for India’s economy. Its is the largest provider of employment in Rural India. Over 70 percent household depends on agriculture. Its provides raw materials to industries and market for industrial product(Kekane, 2013).

Therefore, agriculture is a main sector for the planning of social and economic development of the country. Rapid growth of agriculture is essential not only to achieve self reliance at national level but also for household food security and to bring about equity in distribution of income and wealth resulting in rapid reduction in poverty line (Shrivastava et al. 2010). Agriculture is considered as the biggest unorganized sector where large numbers of women are working for their livelihood. The farm women comprise a quarter of the word’spopulation . Women also make up 41 percent of the word’s agriculture labour force, a ratio which rises to 49 percent for low income countries (ILO,2018).

Women play an important role towards the growth of the agricultural sector and its other associated areas. They perform multifarious tasks in agriculture and its allied fields. They are playing an important role in most of the farm operation like land preparation, seed treatment, sowing, planting, weeding, intercultural operation, irrigation of crop, application of manures and fertilizers, protection of crop, harvesting, threshing, storage etc. There is hardly any activity in agricultural production, except ploughing in which women are not actively involved. In some of the farm activities like processing and storage, women are dominant so strongly those men workers numerically insignificant (Patil and Babus 2018).Naidu et al. (2020) found that 63 percent of women are engaged in sowing of seeds and transplanting followed by in harvesting operation (61%), wedding (59%), winnowing (27%), manure and fertilizer application (25%) on regular basis.

Introduction

The Wadi project mainly involves development of orchard (locally known as Wadi) on degraded lands. Mango, Cashew, Guava, Custard apple, Aonla, Lemon, Sapota and Drumstick are the major fruit crops that are cultivated by the tribal through Wadi project. Wadi is a comprehensive project for improving living standards and socio-economic condition of tribal families in remote areas. Acceptance of new idea is not a unit act but a complex process which involves a series of thoughts and actions. In other words, it is known as mental process through which an individual passes from first hearing about an innovation to final adoption. The components of Wadi project so far developed in recent has been for increasing the agriculture and horticulture production and productivity hence, it requires proper adoption by the tribal beneficiaries for production. Unless the components of Wadi project are properly adopted to larger extent by the tribal beneficiaries, the desired target cannot be achieved. The study was undertaken on following objectives.

Objectives

1. To study extent of adoption of components of Wadi project.

2. To study component wise adoption of Wadi project by the tribal beneficiaries.

3. To study relationship between profile of the tribal beneficiaries and adoption components.

Introduction

The present world is still dominated by the villages. In sprite of the craze towards city life majority of the people in this globe prefer to stay in their village’s n the midst of nature. Hence the world population is predominantly rural. More than 2/3 the world’s population still lives in villages. India is basically a land of villages. In spite of the increase trend towards urbanisation Indian societies become meaningful and fruitful only if the villages and there problems are studies carefully. Villages existed in India even during the Vedic period and also prior to that. Some even described these villages as self contained little republics.

Tripura is a state in North-East India which borders Bangladesh, Mizoram and Assam. It is surrounded by Bangladesh on its north, south and west: the length of its international border is 856 km. It shares a 53 km long border with Assam and a 109 km long border with Mizoram. The state is connected with the rest of India by only one road (NH-44) that runs through the hills to the border of Karimganj District in Assam and then winds through the states of Meghalaya, Assam and North Bengal to Calcutta. At the time of Tripura’s merger with effect from October 15 1949 with the Indian Union, the major mode of farming was shifting cultivation or ‘jhum’, which produced little surplus. A small proportion of the plain lands of the State were under settled agriculture undertaken by Bengalis, and the main crop was rice. Most of the plain lands of the State were not under cultivation and were covered with cane-brakes and marshes. Thus at the time of formation of the State, the economy was predominantly agricultural and forest-based, with no industrial base, a low level of urbanization and limited infrastructure.