eChapters

10.1. Introduction

Irrigation facilities are created by the Government at huge cost for supplying water to the farmers for raising crops to increase agricultural production. The major and medium irrigation projects are planned, constructed, managed, operated and maintained by the Irrigation Departments, wherein certain procedures and rules are evolved and followed to the delivery schedule of canals, frequency of supply and distribution of water to the farmers, and closing of canals. The creation of such facilities resulted in ushering the green revolution in the sixties and seventies in the production of food grains and also employment generation in the country, thereby improving the socio-economic condition of Indian farmers. However, optimized management of irrigation water is the key to the sustainable development of agriculture and livestock. Since management of water for irrigation is highly location-specific, depending upon agro-ecological and socio-economic conditions, type of irrigation project and land use pattern, it differs from project to project and region to region in the country.

9.1. Introduction

Human dependence on natural processes for the goods and services provided by nature, especially food, fuel and fibre, has been a known fact. In recent times, the value of less tangible services, such as climate control, water f iltration, and soil fertility, as well as recreational and cultural services has been emphasized also. Ecosystem services underpin human existence, health, and prosperity. It has been beneficial to humans through the transformations of resources (or environmental assets, including land, water, vegetation, and the atmosphere) into a flow of essential goods and services like clean air, water, and food (Costanza et al., 1997). Ecosystem services are those functions of ecosystems- including agroecosystems that are useful to humans or supportive of human well-being (Kremen, 2005). Services provided by ecosystems receive little notice for their support to human civilization often leading to poor management of the ecosystems. Land use systems influence ecosystem functions, which determine the supply of ecosystem services. Land and water resources are under considerable pressure from the expansion of cultivated and residential lands. Diverse land use in agrarian landscapes not only fosters biodiversity, but also provides potential ecosystem services such as air cleaning by vegetation, natural water filtration by plant roots, natural pest suppression, soil conservation, nutrient retention, and crop pollination by insects, etc. Lowland floodplains or waterlogged land areas are generally more conscious of the benefits provided by ecosystem services. It is important to create awareness among the people on provisioning services provided by ecosystems, such as crops, biofuel, fresh water, natural medicine, wildlife, and several cultural services. Managing ecosystem services, which link human well-being to conservation outcomes, is essential for achieving the sustainable development goals (SDGs) of the United Nations (Zhang, 2017).

8.1. Biofloc aquaculture

Among the innovations in the field of aquaculture, biofloc technology (BFT) has attracted great attention due to its ability to foster the goals of sustainable aquaculture (Khanjani et al., 2022a). If implemented correctly, BFT capitalizes on the existing organisms in water to significantly reduce water use and environmental impact and increase biosafety at farms (Avnimelech, 2012).

7.1. Introduction

The integrated farming system (IFS) is becoming increasingly important for effective farm resource management in order to increase farm productivity, reduce environmental degradation, improve the quality of life for resource-poor farmers, and ensure sustainability. Integration happens when one production sub-system's outputs (typically by-products) are used as inputs in another within the farm unit (Radhammani et al., 2003; Lightfoot and Minnick, 1991). IFS are a mixed farming system made up of at least two distinct but logically linked components of crop and animal enterprises. The integrated farming system is effective in reducing risk, increasing productivity and revenues, and improving the use of organic waste and agricultural leftovers.

5.1. Introduction

Rice-fallows are a rainfed rice mono-crop production system, where only a single crop (rice) is grown and these lands remain without any crop for the rest of the period of the year (fallow). An estimate shows that rice-fallow areas extended over 22.3 M ha in South Asia, maximum in India ( 88.3%) followed by Bangladesh (8.7%), Nepal (1.4%), Sri Lanka (1.1%), Pakistan (0.5%), and Bhutan (0.02%) (Gumma et al., 2016). The eastern part of India accounts for ~ 84% (9.7 million ha) of the country’s total rice-fallow area (i.e. 11.7 million ha) (Ali et al., 2014; Singh et al., 2017), despite high rainfall during rainy / monsoon season. The reasons are that after the rainy season, irrigation facilities are lacking, very fast depletion of the soil residual moisture due to temperature rise, the poor economic condition of the farmers, and a lack of awareness or knowledge of available technologies. Additionally, delayed harvesting of long-duration rice (150-160 days) results in late sowing of winter crops, which, in turn, exacerbates the temperature and moisture stresses in winter crops (Kumar et al., 2018a; 2018b). Overall, the challenges of growing another crop in rice-fallow areas are the lack of irrigation facilities including declining groundwater levels, the dominance of the long-duration rice varieties cultivation, higher evaporative loss of the residual soil moisture, degradation of soil quality, and poor financial conditions of the farming community with diminishing profit. Recently, climate change with erratic rainfall and delayed monsoon arrival added more challenges for these areas in several places. Deficit soil moisture imposes stress on the crops and negatively affects the winter crops productivity in the rice-fallow system, and several times it results in complete crop failure (Singh et al., 2012; Ghosh et al., 2016).

4.1. Introduction

Globally, rice is cultivated on about 165 million ha of land, which provides around 787 million tons of paddy annually (FAO, 2023). In Asia, 708 million tons of paddy is produced from nearly 143 million rice-cultivated areas. Rice crop is grown in a wide range of climates, varied soil types, and hydrological situations. Rice is the lone cereal crop that grows well in floods.

The rice habitat can be divided into four groups based on the hydrology of the rice field: irrigated lowland rice (79~80 million ha), rainfed lowland rice (54~55 million ha), upland rice (14~15 million ha), and flood-prone rice (11~12 million ha) (Table 4.1) (Bouman et al., 2006).

3.1. Introduction

Rice is grown in varying geographical locations and climatic situations. Most of the rice area lies between the equator and 400 N latitude and between 700 and 1400 E longitude. It grows well from tropical to sub-tropical warm and temperate climatic regions up to 400 S and 500 N of the equator. However, the highest yields are obtained in the region between 300 and 450 N of the equator. The average yield generally increases as the countries are situated further away from the equator (Chatterjee and Maiti, 1985). In India, rice grows in regions from 80 N to 350 N latitudes under widely varying conditions of the land, rainfall, altitude and climatic conditions. It is grown at the sea level in river deltas as in parts of Kerala, as deepwater in states of West Bengal, Assam and Bihar; at high altitudes of 914 to 1524 m or even more as in Kashmir, and in the slopes of the Himalayas. A temperature range of 200 C to 37.70 C is required throughout the life period of rice crop.

2.1. Introduction

Water plays a pivotal role in this earth system. The withdrawal of water for irrigation is about 70% of the global freshwater. Water use efficiency is less than 50% in many countries. It has been forecasted by the Food and Agricultural Organization (FAO, 2015) that global water requirements will be increased by 50% by the year 2050 to meet the demands of agricultural water use. This is so because food demand will be higher for the growing human population. We have entered into an earth system where everything living has evolved and developed (Cosgrove and Loucks, 2015). There has been a new geological scenario, some say Anthropocene (Crutzen, 2002; Williams et al., 2011). Consequently, freshwater will increasingly be a scarce and the costliest resource in the future, which needs to be managed properly.

1.1. Introduction: India’s present population, growth rate & projections

India is the second-most populous country in the world after China with its population of about 1.38 billion in the year 2020. The Population Division under the Department of Economic and Social Affairs, of the United Nations, has projected the country’s population to be growing to about 1.50 billion by the year 2030, and 1.64 billion by 2050, of course with its decreasing annual growth rate from 1.04 to 0.25% or so during the period of next thirty years (Fig. 1.1; UNDESA, 2019). The projection says the Indian population will exceed China by the year 2030 even with its decreasing rate i.e. India will be the most populous country by then. As agriculture and allied sectors are the backbone of this country and the largest livelihood source, it support this growing human and livestock population with diversified natural resources and varied agro-climatic conditions. However, the sustainability of agricultural production should be maintained in the face of perturbation and stress on the agro-ecosystem especially the degraded natural resource base and changing climate.

6.1. Introduction

The growing human population presents a number of issues, including food scarcity, malnutrition, inadequate natural resources (land and water) for agricultural production, and environmental deterioration (MacDonald, 2010). Today, viable intensification of agri-production systems can fulfill rising food, nutrition and environmental demands (Pretty and Bharucha, 2014). Production of rice (Oryza sativa L.), a vital element of food security, which feeds nearly half of the world's population, occupies 143 million hectares of land (FAOSTAT, 2023), and uses up to 90% of all irrigation water in Asia (Liu et al., 2018). For instance, it has been determined that systems for producing rice are one of the main industries that wastes water resources and greatly increases greenhouse gas emissions (FAO, 2013). Therefore, it is necessary to look for ways to manage the rice production system more effectively. In paddy rice systems, co cultivating aquatic animals (fish, shrimp, crab, shellfish, and ducks) and rice has been suggested as a way to reduce the risks of environmental pollution/ contamination linked with rice production while simultaneously optimizing the use of land and water resources to provide humans with both grains and meat (Hu et al., 2016; Ahmed and Garnett, 2011). Co-culture systems have drawn more interest recently due to their potential to reduce the stresses associated with environmental and food insecurity.

13.1 Introduction

13.1.1 Bridging the Gap: Towards a More Equitable Digital Landscape

In an age dominated by digital technologies, the concept of a more equitable digital landscape is paramount to ensuring that the benefits of technology are accessible to all segments of society. The term "digital landscape" encompasses not only the physical infrastructure, such as internet connectivity and hardware, but also the socio-economic and educational factors that influence individuals' ability to participate in the digital realm. The digital divide, often exacerbated by disparities in access to technology, internet connectivity, and digital literacy, presents a significant challenge. This paper, titled "Bridging the Gap: Towards a More Equitable Digital Landscape," seeks to explore the multifaceted nature of the digital divide and propose strategies to overcome these challenges.

12.1 Introduction

Technological advancements have completely changed human existence, bringing about profound societal shifts and stimulating the economy. Empowering women will have a good impact on women's daily lives and is essential to the growth of any society. Women now have many possibilities to showcase their creativity, ideas, and technological prowess both in India and around the world thanks to the advancements and inventions in the field of information technology. This review's main goal is to investigate how women use digital technology in urban and rural areas. India is rapidly digitizing, embracing all facets of technological advancement, and as a result, offering plenty of job prospects for women.To reduce the disparity between genders in technology fields in Indian society, women's involvement in these fields, both in rural and urban areas, must be the main focus.

18.1 Introduction

Unpacking the rural landscape having various challenges due to its complex and composite nature.

The development of successful plans and policies requires an awareness of the following issues.

18.1.1 Heterogeneity of Rural Areas

Rural landscapes are diverse, exhibiting variations in geography, culture, and economic activities. Addressing the unique needs of different regions requires a modulation approach (Cloke & Milbourne, 1992). Different topographies, such as hills and plains, have an effect on farming practices. Economic heterogeneity results from the use of various farming techniques and the presence of various sectors. Socially, these locations are characterised by diverse ethnic groups with a diversity of cultures. Access to healthcare and education is restricted by inequalities in infrastructure and services, which add to the uneven development.

17.1 Introduction

In an era where digital technologies permeate every facet of our lives, the discourse surrounding data privacy and security has never been more pertinent. However, within this discourse lies a critical blind spot the intersectionality of gender and technology. As we navigate the complexities of safeguarding personal data and ensuring online security, it is important to recognise and address the differential impacts experienced by individuals based on their gender identities. The combination of gender dynamics with data privacy and security unveils a multifaceted landscape characterised by unique challenges and opportunities. This intersectionality necessitates an examination that goes beyond conventional approaches, requiring a critical lens that acknowledges the diverse experiences and power dynamics at play.

16.1 Introduction

16.1.1 Definition of Sustainable Ecosystems

A sustainable ecosystem is a complex network of living organisms and their non-living environment that can maintain itself and its processes indefinitely. This includes the interaction of plant and animal life, water, air, soil, and other physical and chemical components. These interactions ensure a delicate balance that allows the ecosystem to thrive and provide essential resources for all living beings, including humans. 

15.1 Introduction

15.1.1 Empowering Women for a Sustainable Future in India

Education and opportunity are key to a thriving future, and investing in women's education empowers not just them but also the next generation. India's vast natural resources offer countless benefits, but centuries of human activity have taken a toll. Unsustainable practices and mismanagement have degraded the environment, threatening the well-being of communities across the country. The evidence of environmental decline is undeniable. Over the past decade, the situation has worsened. Our actions are pushing us towards a potential environmental crisis. India, like the earth itself, sustains a multitude of activities. This has undeniably improved lives, particularly in recent decades.

14.1 Introduction

As discussed above, the development discourse on women nationally and internationally moved from Women in Development (WID) to Gender and Development (GAD) and Women's Empowerment. This was reflected in the Government Plans and Policy Documents throughout the past six decades. Since independence, many schemes have been launched for the emancipation of women in the country.

The social welfare method was superseded by the development strategy in the Fifth Five-Year Plan (1974-1979). This acknowledged the contribution and productive role of women. With its emphasis on work, education, and health, the Sixth Five-Year Plan (1980-1985) marks a turning point in the history of women's growth. The Seventh Five-Year Plan (1985-1990) prioritized projects aimed at improving women's status.

11.1 Introduction

Gendered Advancements utilize strategies of sex and intersectional investigation to form modern information. It looks to saddle the inventive control of this sort of examination for advancement and revelation. The agent's address is, do considering these components include important measurements to investigate? Do they take research in unused bearings? To reply to these questions, Gendered Developments creates down-to-earth strategies of sex, sexual orientation, and intersectional examination for researchers and gives case ponders as concrete outlines of how this sort of investigation leads to revelation and advancement.

10.1 Introduction

The incredible technology usage in e-commerce over the last several years has resulted in the fast growth of e-business enterprises. Technological innovation has created new opportunities for online businesses looking to provide value added services. Technology adoption, enhanced customer support, and creative product development have given businesses the necessary competitiveness. Consumers are more demanding than ever and more aware of their rights. E-commerce businesses are pressured to develop and provide value for their customers in novel ways.

9.1 Introduction

In the 21st century, mass media plays an important role in disseminating quick information among many people and making communication easy. Today, Information and Communication Technology (ICT) plays a significant role in daily life. ICT is the abbreviation for Information Technology (IT), which offers the ability to access information using telecommunication. It is primarily dependent on communication technologies. This incorporates computer system, sound video show and Internet. Information and communication technology is used in the majority of fields, for example, Agriculture, Education, Medicine, Defence, E-administration, E-Commerce, Banking, Transport, and so forth. ICT is assuming an essential job.

8.1 Introduction

Giving people and companies access to basic financial services is known as f inancial inclusion, and it has long been a problem on a global scale. Millions of people worldwide still lack access to basic banking services like savings accounts, loans, and insurance and are either underbanked or unbanked altogether. Fintech, or financial technology, has emerged as a key player in resolving this problem by providing creative ways to improve banking service accessibility and advance financial inclusion.

One of the main forces behind promoting equitable economic growth and lowering poverty is financial inclusion.

7.1 Introduction

The evolution of the digital landscape has been nothing short of revolutionary, shaping the way we live, work, and interact with one another. Since the inception of the ARPANET military experiment in 1968, which laid the groundwork for the internet as we know it today, the world's digitization has been accelerating at an unprecedented pace. What started as a military endeavor has evolved into a global network connecting billions of people across geographical boundaries, giving rise to virtual communities, and fundamentally transforming the way information is accessed and disseminated. As we navigate through this digital age, characterized by rapid technological advancements and an ever expanding digital ecosystem, the role of individuals in this landscape has evolved significantly.

6.1 Introduction

In its broadest sense, literacy stands as a fundamental pillar of youth development, transcending mere reading and writing abilities to encompass critical skills necessary for navigating today's complex world (UNESCO, 2020). Concurrently, connectivity serves as the backbone of digital transformation, facilitating communication, collaboration, and access to information on a global scale (ITU, 2021). Skill development, particularly in digital literacy, has become indispensable in an increasingly digitized society, empowering individuals to thrive in both personal and professional domains (European Commission, 2019).

5.1 Introduction

“Women give life and play a vital role in safeguarding the ecosystem. Technology is the Plow that furrows the soil of justice, enabling women farmers to plant the crops of sustainable development.”

Women are half the people in the world, and they have done better than men in many ways in the last 30 years. But they still face more problems than men, because they do not have the same access to things like money, land, and power. Gender equality is not only a good thing by itself but also good for the economy, society, and the environment. If women and men have the same chances to do things and make decisions, we can have a better way of development that considers the needs of both women and men.

4.1 Indian Rural Women Embracing the Changes

Rural areas are chiefly characterized by a strong reliance on primary industries such as agriculture, forestry, fishing, and mining (MacTavish, 2020). When examined by occupation, the agricultural sector frequently acts as the foundation of rural economies, employing a sizable percentage of workers in farming, livestock raising, and crop production (Cagliarini & Rush, 2011). Unlike urban areas, rural regions offer fewer non-agricultural employment opportunities, leading to a greater emphasis on self-employment, small-scale enterprises, and seasonal work patterns. Limited access to formal employment prompts reliance on informal sectors such as casual labour and subsistence farming.

3.1 Introduction

Women are the backbone of the family. God gave her all the power to give birth, raise the children, do all the household chores, and balance the professional work. But we forget that women are also human beings, not machines. They can’t work 24x7 they also need rest as well as proper nutrition. Women in ancient India were very powerful in terms of decision-making, political opinion, education, etc, but later on, the situation of women deteriorated. In the middle era, the situation was at its worst: women were being treated badly by the men in their own families. Currently, the situation is turning better. Women are being treated equally now times but it is not the best scenario we can have. There is still much scope in this field where equal wedges and a good environment can be provided to the women.

1.1 Introduction Rural women worldwide grapple with many challenges, ranging from restricted access to essential resources and limited educational opportunities to constrained pathways for economic advancement. Extensive research conducted by the World Bank has illuminated the persistent struggles faced by rural women, emphasizing disparities in education, healthcare, and economic opportunities (World Bank, 2019). Simultaneously, UN Women underscores the systemic hurdles perpetuating gender inequalities, necessitating urgent and comprehensive solutions (UN Women, 2020).

Amidst these challenges, emerging technologies stand as a transformative force with the potential to reshape the trajectories of rural women. Recognizing this potential, the International Telecommunication Union (ITU) emphasizes the capacity of technological interventions to ameliorate challenges faced by women in rural areas.

1.1 Introduction

In the contemporary context, women's empowerment in rural India holds immense significance. These women fulfil critical roles as farmers, wage earners, and entrepreneurs, all while managing family responsibilities such as providing food and caring for children and older people. Despite their vital contributions, rural women face entrenched challenges, including gender based discrimination, societal norms, and unequal access to education, healthcare, property, and financial services. The burden of unpaid work, particularly prevalent in economically disadvantaged households, further compounds these obstacles. Notably, women from indigenous and grassroots communities contribute significantly to their communities’ livelihoods and serve as custodians of traditional knowledge essential for cultural preservation.

Distillation, leaching, and extraction

A. Distillation

Distillation is a widely used separation process in various industries, including chemical, pharmaceutical and food processing. It is particularly important in the production of alcoholic beverages, essential oils, and purified water. Distillation works on the principle of exploiting differences in the volatility of components in a liquid mixture to separate them based on their boiling points.

Principles of Distillation

Distillation is a time-tested and versatile separation technique employed across a myriad of industries for separating components of liquid mixtures. Its effectiveness lies in its ability to leverage differences in boiling points among the various constituents of a mixture.

A. Non-thermal Processing

Non-thermal processing encompasses a diverse range of food preservation and treatment techniques that do not rely on heat as the primary means of achieving microbial inactivation or quality preservation. Unlike conventional thermal methods such as pasteurization and sterilization, which involve exposing food to elevated temperatures for a specified duration, non-thermal processing methods operate at or near ambient temperatures. These innovative technologies offer several advantages, including the preservation of sensory attributes, retention of nutritional quality, and minimization of detrimental effects on food texture and f lavour (fig 1).

A. Novel Dehydration Technologies

Dehydration, the process of removing moisture from food products, is crucial for enhancing shelf life, reducing weight and volume for transportation, and preserving nutritional value. Traditional dehydration methods, such as sun drying, air drying, and freeze drying, have been widely used for centuries. However, advancements in food technology have led to the development of novel dehydration technologies that offer improved efficiency, quality retention, and sustainability.1. Vacuum Microwave Dehydration

Vacuum microwave dehydration is a cutting-edge dehydration technique that combines the advantages of removing moisture from food products while preserving their color, flavor, texture, and nutritional content (fig 1).

Food Plant Hygiene

A. I.mportance of Food Plant Hygiene:

1. Ensures the Safety and Quality of Food Products: Proper hygiene practices within food processing facilities play a critical role in safeguarding the safety and quality of food products. By adhering to stringent hygiene protocols, including thorough cleaning, sanitation, and preventive measures, facilities can effectively prevent the contamination of food products by harmful microorganisms, chemicals, or physical hazards. This helps minimize the risk of foodborne illnesses and ensures that consumers receive safe and wholesome food products. Additionally, maintaining cleanliness and hygiene in food proce

A. Mixing and Homogenization

1. I.ntroduction to Mixing and Homogenization

In the food industry, mixing and homogenization are fundamental procedures that are essential to the production of a wide range of food items. To produce the desired qualities and final result with uniformity and consistency, various ingredients are blended. Ensuring product quality, stability, and customer happiness are contingent upon these processes.

Importance of Mixing and Homogenization

Mixing and homogenization are paramount for several reason

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

1. Introduction

Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane.

1. Preparation of tissue homogenate

The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface.

Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Polymerase Chain Reaction (PCR) is a laboratory technique, developed by Kary Mullis in the 1980s, used in molecular biology to amplify and replicate a specific segment of the DNA (Mullis, 1990). This reaction in performed in a thermal cycler, involving three main steps: denaturation, annealing and extension.

Principle: PCR is based on the principle of selectively amplifying a specific region of DNA through a series of temperature-controlled cycles. The key components involved in PCR include the target DNA sequence, oligonucleotide primers, DNA polymerase enzyme (Taq DNA polymerase), deoxyribonucleotide triphosphate (dNTPs) (A, T, G, and C), Mg2+ and a thermal cycler apparatus. Initially, the double-stranded DNA is split into single strands under high temperature of 90-95 0C known as the denaturation step. It is followed by cooling the solution to a temperature that allows proper attachment of the oligonucleotide primers to its complementary sites in the strands, known as the annealing step.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Requirements: Clipboard, Pencils, Hand lens, Pocket knife, insect catching nets, attractants, spread sheet Collection bags and vials, Camera etc.

Sampling techniques are used to draw valid inferences about the population parameters using the sample statistics

Components of an insect sampling program 

Knowledge of pest and beneficial insects

Identification

 Life cycle and biology

Injury caused

Sample: Sample is a subgroup of the population. It is defined as a collection of individual observations from the population about which inferences are to be made, and is obtained by a specific method.

Sprayers

Sprayer is a machine used to apply liquid chemicals on plants to control pest and diseases. It can also be used to apply herbicides to control weeds and to spray micro nutrients to enhance plant growth. The main functions of a sprayer are

•             Breaking the chemical solution in to fine droplets of effective size.

 •            Distributing the droplets uniformly over the plants.

 •            Applying the chemicals with sufficient pressure for positive reaching the plants

 •            Regulating the amount of liquid applied on plants to avoid excessive application.

Requirements: Insecticides of different types

Insecticide chemicals in their “raw” or unformulated state are not usually suitable for pest control. These concentrated chemicals and active ingredients may not mix well with water, may be chemically unstable, and may be difficult to handle and transport. For these reasons, manufacturers add inert substances, such as clays and solvents, to improve application effectiveness, safety, handling, and storage. Inert ingredients do not possess Insecticidal activity and are added to serve as a carrier for the active ingredient. Manufacturers will list the percentage of inert ingredients in the formulation or designate them as “other ingredients” on their labels.

Requirements: Agriculturally important insects of each order

 Orthoptera

 Examples: Grasshopper, cricket, etc.

Metamorphosis: Paurometabolous

Mouthparts: Chewing

 Significance: Variable or Pest

 Characteristics

 •            They are medium to large-sized insects.

 •            Antenna is filiform.

 •            Mouthparts are mandibulate.

 •            Prothorax is large. The pronotum is curved, ventrally covering the pleural region.

•             Hindlegs are saltatorial

 •            Forewings are leathery, thickened and known as tegmina.

 •            They are capable of bending without breaking.

 •            Hindwings are membranous with large anal area.

 •            They are folded by longitudinal pleats between veins and kept beneath the tegmina.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Pull the cut sides apart and observe the internal organs. Pin the sides of the insect to the dissecting pan. The observation of the reproductive systems of males and females are as follows:

Female reproductive system

The main functions of the female reproductive system are egg production and storage of male spermatozoa until the eggs are ready to be fertilized. The basic components of the female system are paired ovaries, which empty their mature oocytes (eggs) via the calyces (Calyx) into the lateral oviduct which unite to form the common (median) oviduct.

The best learning situation requires one specimen and set of tools per two students for studies. Students working in pairs have ample opportunity to fully participate in the dissection and to carefully examine the specimen. They are also able to share and discuss their observations during and after the dissection.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Metamorphosis and immature stages

The change in growth and development (form) of an insect during its life cycle from birth to maturity is called metamorphosis. There are four basic types of metamorphosis in insects.

Ametabola: (No metamorphosis) e.g. Silver fish.

These insects have only 3 stages in their life cycle namely egg, young ones and adults. It is most primitive type metamorphosis. The hatching insects resemble the adult in all respects except for the size and called as juveniles. Moulting continues throughout the life.

Hemi-metabola: (Incomplete metamorphosis) e.g. Dragonfly, damselfly and may fly.

These insects also have 3 stages in their life namely egg, young ones and adults. The young ones are aquatic and are called naiads. They are different from adults in habits and habitat. They breathe by means of tracheal gills. In dragonfly naiad, the lower lip (labium) is called mask which is hinged and provided with hooks for capturing prey. After final moult, the insects have fully developed wings suited for aerial life

The complete system of veins of a wing is termed venation or neuration. Generally in all the insects, there is some similarity in wing venation and therefore, it is presumed that all types of wing venation have developed from the common base or the same ancestor. Using an extensive study of wing venation in different groups of insects, Comstock and Needham constructed a hypothetical type of wing venation from which all other types have presumably been derived. According to them the primitive wing venation has developed from two tracheae which are situated on the anterior and the posterior basal margins of wings and their branches are spread all over the wing.