eChapters

9.1 Introduction

In the 21st century, mass media plays an important role in disseminating quick information among many people and making communication easy. Today, Information and Communication Technology (ICT) plays a significant role in daily life. ICT is the abbreviation for Information Technology (IT), which offers the ability to access information using telecommunication. It is primarily dependent on communication technologies. This incorporates computer system, sound video show and Internet. Information and communication technology is used in the majority of fields, for example, Agriculture, Education, Medicine, Defence, E-administration, E-Commerce, Banking, Transport, and so forth. ICT is assuming an essential job.

8.1 Introduction

Giving people and companies access to basic financial services is known as f inancial inclusion, and it has long been a problem on a global scale. Millions of people worldwide still lack access to basic banking services like savings accounts, loans, and insurance and are either underbanked or unbanked altogether. Fintech, or financial technology, has emerged as a key player in resolving this problem by providing creative ways to improve banking service accessibility and advance financial inclusion.

One of the main forces behind promoting equitable economic growth and lowering poverty is financial inclusion.

7.1 Introduction

The evolution of the digital landscape has been nothing short of revolutionary, shaping the way we live, work, and interact with one another. Since the inception of the ARPANET military experiment in 1968, which laid the groundwork for the internet as we know it today, the world's digitization has been accelerating at an unprecedented pace. What started as a military endeavor has evolved into a global network connecting billions of people across geographical boundaries, giving rise to virtual communities, and fundamentally transforming the way information is accessed and disseminated. As we navigate through this digital age, characterized by rapid technological advancements and an ever expanding digital ecosystem, the role of individuals in this landscape has evolved significantly.

6.1 Introduction

In its broadest sense, literacy stands as a fundamental pillar of youth development, transcending mere reading and writing abilities to encompass critical skills necessary for navigating today's complex world (UNESCO, 2020). Concurrently, connectivity serves as the backbone of digital transformation, facilitating communication, collaboration, and access to information on a global scale (ITU, 2021). Skill development, particularly in digital literacy, has become indispensable in an increasingly digitized society, empowering individuals to thrive in both personal and professional domains (European Commission, 2019).

5.1 Introduction

“Women give life and play a vital role in safeguarding the ecosystem. Technology is the Plow that furrows the soil of justice, enabling women farmers to plant the crops of sustainable development.”

Women are half the people in the world, and they have done better than men in many ways in the last 30 years. But they still face more problems than men, because they do not have the same access to things like money, land, and power. Gender equality is not only a good thing by itself but also good for the economy, society, and the environment. If women and men have the same chances to do things and make decisions, we can have a better way of development that considers the needs of both women and men.

4.1 Indian Rural Women Embracing the Changes

Rural areas are chiefly characterized by a strong reliance on primary industries such as agriculture, forestry, fishing, and mining (MacTavish, 2020). When examined by occupation, the agricultural sector frequently acts as the foundation of rural economies, employing a sizable percentage of workers in farming, livestock raising, and crop production (Cagliarini & Rush, 2011). Unlike urban areas, rural regions offer fewer non-agricultural employment opportunities, leading to a greater emphasis on self-employment, small-scale enterprises, and seasonal work patterns. Limited access to formal employment prompts reliance on informal sectors such as casual labour and subsistence farming.

3.1 Introduction

Women are the backbone of the family. God gave her all the power to give birth, raise the children, do all the household chores, and balance the professional work. But we forget that women are also human beings, not machines. They can’t work 24x7 they also need rest as well as proper nutrition. Women in ancient India were very powerful in terms of decision-making, political opinion, education, etc, but later on, the situation of women deteriorated. In the middle era, the situation was at its worst: women were being treated badly by the men in their own families. Currently, the situation is turning better. Women are being treated equally now times but it is not the best scenario we can have. There is still much scope in this field where equal wedges and a good environment can be provided to the women.

1.1 Introduction Rural women worldwide grapple with many challenges, ranging from restricted access to essential resources and limited educational opportunities to constrained pathways for economic advancement. Extensive research conducted by the World Bank has illuminated the persistent struggles faced by rural women, emphasizing disparities in education, healthcare, and economic opportunities (World Bank, 2019). Simultaneously, UN Women underscores the systemic hurdles perpetuating gender inequalities, necessitating urgent and comprehensive solutions (UN Women, 2020).

Amidst these challenges, emerging technologies stand as a transformative force with the potential to reshape the trajectories of rural women. Recognizing this potential, the International Telecommunication Union (ITU) emphasizes the capacity of technological interventions to ameliorate challenges faced by women in rural areas.

1.1 Introduction

In the contemporary context, women's empowerment in rural India holds immense significance. These women fulfil critical roles as farmers, wage earners, and entrepreneurs, all while managing family responsibilities such as providing food and caring for children and older people. Despite their vital contributions, rural women face entrenched challenges, including gender based discrimination, societal norms, and unequal access to education, healthcare, property, and financial services. The burden of unpaid work, particularly prevalent in economically disadvantaged households, further compounds these obstacles. Notably, women from indigenous and grassroots communities contribute significantly to their communities’ livelihoods and serve as custodians of traditional knowledge essential for cultural preservation.

Distillation, leaching, and extraction

A. Distillation

Distillation is a widely used separation process in various industries, including chemical, pharmaceutical and food processing. It is particularly important in the production of alcoholic beverages, essential oils, and purified water. Distillation works on the principle of exploiting differences in the volatility of components in a liquid mixture to separate them based on their boiling points.

Principles of Distillation

Distillation is a time-tested and versatile separation technique employed across a myriad of industries for separating components of liquid mixtures. Its effectiveness lies in its ability to leverage differences in boiling points among the various constituents of a mixture.

A. Non-thermal Processing

Non-thermal processing encompasses a diverse range of food preservation and treatment techniques that do not rely on heat as the primary means of achieving microbial inactivation or quality preservation. Unlike conventional thermal methods such as pasteurization and sterilization, which involve exposing food to elevated temperatures for a specified duration, non-thermal processing methods operate at or near ambient temperatures. These innovative technologies offer several advantages, including the preservation of sensory attributes, retention of nutritional quality, and minimization of detrimental effects on food texture and f lavour (fig 1).

A. Novel Dehydration Technologies

Dehydration, the process of removing moisture from food products, is crucial for enhancing shelf life, reducing weight and volume for transportation, and preserving nutritional value. Traditional dehydration methods, such as sun drying, air drying, and freeze drying, have been widely used for centuries. However, advancements in food technology have led to the development of novel dehydration technologies that offer improved efficiency, quality retention, and sustainability.1. Vacuum Microwave Dehydration

Vacuum microwave dehydration is a cutting-edge dehydration technique that combines the advantages of removing moisture from food products while preserving their color, flavor, texture, and nutritional content (fig 1).

Food Plant Hygiene

A. I.mportance of Food Plant Hygiene:

1. Ensures the Safety and Quality of Food Products: Proper hygiene practices within food processing facilities play a critical role in safeguarding the safety and quality of food products. By adhering to stringent hygiene protocols, including thorough cleaning, sanitation, and preventive measures, facilities can effectively prevent the contamination of food products by harmful microorganisms, chemicals, or physical hazards. This helps minimize the risk of foodborne illnesses and ensures that consumers receive safe and wholesome food products. Additionally, maintaining cleanliness and hygiene in food proce

A. Mixing and Homogenization

1. I.ntroduction to Mixing and Homogenization

In the food industry, mixing and homogenization are fundamental procedures that are essential to the production of a wide range of food items. To produce the desired qualities and final result with uniformity and consistency, various ingredients are blended. Ensuring product quality, stability, and customer happiness are contingent upon these processes.

Importance of Mixing and Homogenization

Mixing and homogenization are paramount for several reason

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

1. Introduction

Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane.

1. Preparation of tissue homogenate

The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface.

Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.