eChapters

It’s because it impacts the active development of the plant at a low temperature. Yellowing of the leaves and severe destruction of the tissue. In cases of flowering plants, the stalk carrying the bunches freely lengthens and drapes down the complete inflorescence.

Ber (Ziziphus mauritiana L) ancient fruit of India grown in arid regions, ‘king of arid zone fruits’, thrive well in marginal areas. During severe hot, it shed off its leaves completely and thus conserves moisture by getting rid of transpiration mechanism. Flowering and fruiting mainly take place on secondary and tertiary branches.

Objective: To study the seed germination, pollination and dispersal type of various temperate tree species.

Observation recording: To record the observation on seed germination, Pollination and dispersal needs to conduct frequent field visits in different seasons for recording the various pollination and dispersing agents and conducting experiment on seed germination.

To reduce the dependence on hazardous pesticides in modern agriculture, one of the most promising ways is to use insect-resistant cultivars. When available, planting resistant cultivars is one of our most effective, economically viable and environmentally sound tactics. The underlying concept of using host resistance to our advantage comes from the knowledge that most plants and animals are resistant to most potential insect attackers.

Abstract

The Basic Local Alignment Search Tool, or BLAST, is an online tool provided by the National Center for Biotechnology Information (NCBI) that allows users to search for matches between their query sequences and the sequences stored in NCBI databases. BLAST can be used to search for nucleotide sequences against nucleotide sequences, protein sequences against protein sequences, and protein sequences against translated nucleotide sequences in the databases. BLAST is widely used to study sequence similarity, identify target sequences, analyze the functional aspects of molecular sequences, and investigate evolutionary relationships. This chapter details on the BLAST and its applications.

Fruit trees can be planted in the backyard or any open space near the house. In absence of backyard area, fruit trees can also be grown on the rooftop by planting in polythene bag, plastic container, cemented pot, etc. Growing fruits like papaya, banana, lemon, mango, pineapple, coconut, pomegranate, etc. in the premises of house can fulfil the family requirement of fruits. It will help to get fresh fruits from own garden, which are free from any chemical or pesticide. There is a different satisfaction in plucking of fruits grown by own effect.

Mango

Mango (Mangifera indica) is one of the prominent fruit crops of India. It has delicious taste and excellent flavour. Mango fruit is utilized at all the stages of its development. Raw fruits are used for preparation of pickle, chutney and juice. The ripe fruits are consumed directly and are used for preparation of several products like squash, syrup, jam and jelly. Ripe mango contains about 0.6 per cent protein, 0.1 per cent fat, 11.8 per cent carbohydrate, 0.3 per cent minerals and 1.1 per cent fibre. 

Citrus genus belongs to the family Rutaceae that comes in various forms and sizes (from round to oblong) that commonly known as oranges, mandarins, limes, lemons and citrons. Besides being consumed as raw/fresh fruits, they are also used in the industries of beverages, cosmetic and pharmaceuticals. Citrus fruits have got abundant quantity of vitamin-C and other micronutrients like sugars, dietary fiber, potassium, folate, calcium, thiamin, niacin, vitamin B6, phosphorus, magnesium, copper, riboflavin and pantothenic acids etc. (Economos, 1999). Secondary metabolites like flavonoids, limonoids, coumarins, alkaloids, phenolic acids and other essential oils of this fruit also have anti-oxidative, anti-inflammatory, anti-cancerous as well as cardiovascular protective effects (Lu et al., 2015).

Introduction Palak (Beta vulgaris L. var. bengalensis), also known as spinach beet or perpetual spinach, Saag, Indian Spinach, beet leaf, Swiss chard and Palongpalang. is a leafy green vegetable that is closely related to Swiss chard (Beta vulgaris subsp. vulgaris). And it belongs to the family Chenopodiaceae. It is a popular and versatile vegetable known for its nutritious leaves and mild flavour. Palak shares similarities with both spinach (Spinacia oleracea) and beetroot (Beta vulgaris). The leaves of palak are tender and similar in appearance to spinach leaves. They are dark green and have a slightly glossy texture. The flavour of palak is milder compared to spinach, with a pleasant earthy taste. This makes it a versatile ingredient that can be used in various culinary preparations. Palak is often grown as a cool-season vegetable, as it can tolerate cool temperatures better than spinach. It is appreciated for its ability to produce a continuous harvest of leaves over an extended period, hence the name “perpetual spinach.” This characteristic makes it a valuable addition to home gardens and commercial production.

1.1 General

Biomass is a renewable and plentiful energy source with enormous potential to meet the rising demand for clean and sustainable energy solutions. This chapter offers an overview of biomass and its conversion technology, which includes various techniques to transform biomass into useful forms of energy like heat, electricity, and biofuels.

Biomass is an organic substance obtained from plants, animals, and microorganisms. It can be utilized as a source of energy or as a basic material in various applications. The energy in biomass is derived from photosynthesis, during which plants convert sunlight, carbon dioxide, and water into organic matter. Since it comes from living or recently deceased organisms, it is a sustainable and renewable resource. In terms of carbon dioxide emissions, biomass is considered a carbon-neutral energy source because the carbon dioxide produced during combustion is offset by the carbon dioxide absorbed by plants during their growth.

Participatory curriculum development (PCD) in extension education is an emerging approach to help and improve the quality of education in farm universities. The main steps of the PCD approach adopted here have high practical utility for the design of formal course contents for the Undergraduate and Postgraduate courses in Agricultural Extension. A great deal of thinking is required while deciding on how much participation will be required from which stakeholders, at what level(s).

Introduction

Another limitation in a remote area such as the high-altitude region is the steady supply of wholesome and fresh food. Indian troops are stationed up to 2200 feet above sea level; generally speaking, high altitude is defined as elevations between 8000 and 15,000 feet above sea level. When someone who is not acclimated to high altitudes is exposed, they can experience a set of symptoms known as acute mountain sickness (AMS). One of the most severe symptoms of AMS is hypoxia. There may be neurological and cerebral symptoms, such as diminished ability to focus for extended periods, memory problems, problems with hearing and vision, vertigo and tinnitus, and irritability. The low appetite may persist; additional issues linked to high altitude include anorexia with weight loss, sleeplessness, and physical and emotional exhaustion.

Introduction

Currently, one of the most serious problems facing the world is environmental degradation. Multiple technological tools are required for the detection and remediation of pollutants. Environmental pollution is steadily rising and has an adverse effect on every living organism, including humans. Microorganisms and plants have biosynthetic pathways for the accumulation or breakdown of environmental contaminants from soil and water can minimise it. Because natural microbes and plants lack genetic components, they are less able to absorb or digest contaminants, and as a result, they are currently released at high levels. Plants, animals, and/or microbes are utilised as biological indicators to detect pollution in a particular ecosystem (Zaghloul et al., 2020).

Indicators for Impact Assessment-meaning and Concept

Indicators for impact assessment: Indicators are common tools to determine the performance and then the result of the technology/extension/communication interventions. They measure the accomplishment of the project’s goals and targets. Criteria of indicators should be defined during the formulation stage, but they often need to be specified in greater detail during implementation. The indicators should measure intangible and non-tangible changes, particularly in projects that value factors such as personal and social development.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

This chapter provides a comprehensive overview of the randomized block design (RBD), detailing its theoretical concept, layout, and a detailed segment on pooled ANOVA concepts. It explains the mathematical models for RBD and how to interpret the results from ANOVA tables in this context. The chapter also offers step-by-step guidance for analyzing RBD, Factorial RBD, and pooled RBD ANOVA using R.

Randomized Block Design

The RBD is a widely used experimental design in statistics and research, particularly when dealing with certain specific conditions:

• Homogeneity within blocks: RBD is ideal when there is inherent variability in the experimental units, but this variability can be grouped into homogenous blocks. Each block contains a complete set of treatments, and the blocks themselves account for the variability.

• Principles of experimental design: RBD adheres to the core principles of experimental design, namely randomization, replication, and local control. Randomization is used within blocks to assign treatments, ensuring that the comparison of treatments is fair.

• Replication across blocks: In RBD, each treatment is replicated across different blocks. This replication enhances the reliability and robustness of the experimental results.

• Managing uncontrolled variability: RBD is particularly effective in field experiments or situations where external variability (e.g., soil type, light conditions) cannot be completely controlled. By grouping similar units into blocks, RBD effectively reduces the impact of this uncontrolled variability on the treatment effects.

• Improvement in experimental accuracy: The use of blocks to organize the experimental units usually leads to a reduction in the error variance compared to CRD. This enhances the accuracy and precision of the experiment.

Extension Program

Planning an extension program involves decision- making about the work of the organization. Extension program planning covers a set of objectives to be achieved by various activities included in the planning. Extension organization needs to decide the goal it aims at, the target group, the content of extension message, its use, and organization of all activities. The program includes situation analysis, and an action plan for solving people’s problems which is drawn in advance. Extension workers have to decide the goals, target group, messages, extension methods, and media and organization of activities. While setting the goal, the perception of the present situation and the vision of the desired situation should be borne in mind. The target group is normally larger than the extension worker contacts directly or through mass media. The target group can be contacted indirectly. The extension content depends on the goal, the target group, and the extension strategy. The content should be so selected that it can be implemented with the resources available to the farmers locally. A combination of extension methods need to be used. The extension program needs to be flexible and can be easily implemented by the organization.

Extension Program Planning

Extension program planning indicates an account of the activities to be undertaken by the organization.

The essential phases of program planning in extension are analyzing the situation, setting goals and objectives, identifying problems and gaps, developing work plan, implementation, monitoring and evaluation, and reconsideration.

Introduction

The mammary glands of female mammals secrete milk, a necessary food that is liquid and meets the newborn’s nutritional needs. All mammals consider milk to be a complete food for their newborns. It is considered a necessary food for humans and can be consumed as a product or as liquid milk. It contains almost all essential nutrients except iron, which is very low in milk. In essence, milk is an emulsion of protein and fat in water, supplemented with carbohydrates, vitamins, and minerals.

Definition of Milk

• Milk is a complex biological fluid that differs from species to species in both composition and physical properties. It is the full lacteal secretion of a mammary gland that is obtained by milking mammals for a minimum of 72 h after calving or until the milk is free from colostrum.

• FSSAI defines milk as the normal mammary secretion derived from the complete milking of healthy milch animals. It should be free from colostrum.

From a chemical perspective, milk is a dynamically balanced mixture that comes in different forms such as emulsion, colloidal suspension, and true solution. It also contains varying amounts of proteins, fats, carbohydrates, salts, and water.

Gross Composition of Milk

Milk composition varies among different mammals. The average chemical composition of milk in various species is given in Table 1. Buffalo milk and sheep milk contain higher amounts of fat, while human milk comparatively has the highest lactose content. Human milk has lower protein content as compared to milk of other species.

U value: U value is a measure of the heat transmission through a building part (wall or window) or through a given thickness of a material (insulation). U values with lower numbers indicate better insulating properties (Plate 614).

UHT milk: This milk is homogenized, heated to atleast 135oC for about 2-3 second, cooled rapidly and then packed in sterilized containers aseptically. The milk in packs can be stored for several months without refrigeration. The nutrient loss is negligible. Used for making yogurt commercially as it does not need to be boiled again.

UHT pasteurization: The milk is heated to ~150oC for a fraction of seconds practically no holding period. It is also called ultra pasteurization.

UHT sterilization: It is method in which food is sterilized, cooled and then aseptically placed in previously sterilized containers which are subsequently sealed in an aseptic environment.

Introduction

Cranberry (Vaccinium macrocarpon Aiton) belongs to the Ericaceae family and is native to North America. Cranberries are also known by various other names, including American cranberry, bearberry, and lingonberry. The plant has a diploid chromosome number of 24 and grows in acidic, nutrient-poor soils in wetlands and bogs. It is an important commercial crop worldwide due to its high nutritional value, antioxidant properties, and health benefits. Cranberries are primarily consumed as juice, dried fruit, or in the form of sauces and jellies. They are a rich source of vitamins C and E, dietary fiber, anthocyanins and essential minerals such as potassium, manganese, and copper. The fruit is also used in the pharmaceutical industries due to its anti inflammatory, antimicrobial, and anti aging properties (Santos et al., 2017; Wang et al., 2017).

The composition of cranberries is quite remarkable, with high levels of antioxidants, including phenolic compounds such as flavonols, anthocyanins, and proanthocyanidins. These compounds are responsible for the fruit’s vibrant red color and are thought to provide many of the health benefits associated with cranberries. Cranberries are an important crop in the United States, Canada, and Chile, with significant economic value. They are primarily consumed as juice or in processed forms, such as sauces and jams. Cranberries are also used in the production of dietary supplements and cosmetics.

Fruits and vegetables are perishables and the post-harvest losses from the point of production at the farm gate till it reaches the consumers is estimated as 30-35 per cent which constitute a major economic drain of more than 33 billion USD equivalent to Rs 2,40,000 crores annually. In order to reduce the losses at various stages, nanotechnologies have come as potential strategies to minimize the losses while improving the marketability and profitability of perishables. One of the plants derived natural compounds “hexanal” which is known to extend the shelf-life of fruits when it is used as a pre-harvest spray or post-harvest dip as a nano-emulsion. Since, it is a highly volatile compound, efforts were undertaken to entrap the compound in the polymer-based nano f ibres (as nano stickers) or as a cyclodextrin inclusion complex (as nano pellets) in order to preserve the perishables. Further, hexanal vapour was also evaluated to preserve fruits. In this book chapter, various nanotechnologies tested, evaluated and technologies developed over the years are elucidated. Overall, the literature review suggests that use of any of the nanotechnologies delivered as pre-harvest spray, post-harvest dip, nano-stickers, nano-pellets and vapour singly or in combination found to reduce the infestation of post harvest diseases, minimize the losses and extended shelf-life by 2-3 weeks that help the farmers to get lucrative prices due to the late arrival in the market besides significantly improve the productivity and profitability of orchards.