eChapters

The Internet, new information and communication technologies today are being entrenched into the fabric of our society at a very rapid rate. The Internet has emerged as an extraordinary prominent medium having a tremendous impact on and within society.

Objectives

1. To study the objectives and principles of training and pruning.
2. To study the methods of training and pruning.

Training: It refers to judicious removal of part to develop a proper shape of plant capable of bearing heavy crop load.

Objectives of Training

1. To admit more light and air to the centre of the tree to expose maximum leaf surface to the sun
2. To direct the growth of the tree so that various cultural operations such as spraying, ploughing, harvesting can be performed easily and at lower cost.
3. To protect the tree from sun burn and wind damage.
4. To secure a balanced distribution of fruit bearing parts of the tree.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

U value: U value is a measure of the heat transmission through a building part (wall or window) or through a given thickness of a material (insulation). U values with lower numbers indicate better insulating properties (Plate 614).

UHT milk: This milk is homogenized, heated to atleast 135oC for about 2-3 second, cooled rapidly and then packed in sterilized containers aseptically. The milk in packs can be stored for several months without refrigeration. The nutrient loss is negligible. Used for making yogurt commercially as it does not need to be boiled again.

UHT pasteurization: The milk is heated to ~150oC for a fraction of seconds practically no holding period. It is also called ultra pasteurization.

UHT sterilization: It is method in which food is sterilized, cooled and then aseptically placed in previously sterilized containers which are subsequently sealed in an aseptic environment.

Food security, defined as the availability, access, and utilization of sufficient, safe, and nutritious food for all people at all times, is a critical global challenge. This article examines the multifaceted issues contributing to food insecurity, including population growth, climate change, economic instability, and geopolitical conflicts. It explores the impact of these factors on food production, distribution, and access, highlighting the interconnectedness of global systems. Furthermore, the article discusses various solutions and strategies to enhance food security, such as sustainable agricultural practices, technological innovations, policy reforms, and international cooperation. Emphasizing a holistic and integrated approach, the article argues that addressing food security requires coordinated efforts across sectors and scales, from local communities to global networks. By fostering resilience, equity, and sustainability in food systems, we can move towards a future where everyone has access to the nourishment they need to lead healthy and productive lives.

Lily (Lilium spp.) is a high-value bulbous ornamental plant prized for its large, attractive, and often fragrant flowers. Belonging to the family Liliaceae, lilies are widely grown for cut flowers, landscape decoration, and potted plant markets. Despite its beauty, lily cultivation is often challenged by several insect and mite pests that reduce aesthetic quality, market value, and bulb health.
Biology: Eggs are laid in clusters or singly on the undersides of lily leaves. They are yellowish to pale white, round, and smooth. Incubation lasts for about 3–6 days, depending on temperature and humidity. There are typically 5–6 larval instars. Newly hatched larvae are small and yellowish, later turning bright orange-red with black bands and spots. Caterpillars feed gregariously at first, skeletonizing leaves, then disperse to bore into stems or bulbs in later stages. The larval stage lasts for about 12–20 days. Pupation occurs in the soil, where larvae form a silken cocoon often mixed with soil particles. The pupal stage lasts 7–14 days. Pupae are reddish-brown and cylindrical. The adult is a medium-sized, metallic blue-black moth with bright yellow bands on the forewings and orange markings on the thorax. Adults are nocturnal and feed on nectar. Adult lifespan is around 4–6 days, during which female mate and lay eggs (Sathe, 2015).

INTRODUCTION
A PTO (Power Take Off) in a tractor transfers mechanical power from the engine to various tractor implements or attachments, such as a rotavator, thresher, straw reaper, or super seeder, through a PTO shaft. In India, the PTO is typically located at the rear of the tractor, while in several other countries, a front PTO is also available to power front-mounted machines. Different PTO-driven implements require varying amounts of PTO horsepower (HP) for operation. PTO horsepower indicates the power available for driving tractor attachments, and it is transmitted to these implements via the PTO shaft.
The rear-mounted power outlet, known as the PTO, is used to operate PTOdriven implements like a rotavator, power harrow, and baler. Tractors are used not only for towing implements for tillage and sowing but also for stationary tasks such as crop threshing and water pumping from tube wells, which are powered by the PTO. The PTO-driven implements require a specific amount of horsepower, referred to as PTO HP, to function. This PTO HP is the portion of the engine power used to operate the implements, and it is always lower than the tractor’s total horsepower due to friction losses. Additionally, the PTO shaft derives its power from the gearbox.
There are two standard PTO speeds: 540 rpm and 1000 rpm. This standardization was introduced to ensure that implements are designed to operate efficiently at these speeds. For splines, the 540 rpm shaft has 6 splines, while the 1000 rpm shaft features 21 splines.
THE INVENTION OF PTO IN THE TRACTOR INDUSTRY
In 1918, the International Harvester Company (IHC) introduced the Power Take Off (PTO) in tractors, with Edward A. Johnston, an IHC engineer, being the first to develop the concept after being inspired by homemade PTO systems in France. The 8-16 model became the first commercial tractor to feature PTO. Two

Amaranthus stem weevil: Hypolixus truncatulus :Curculionidae
 
It is an important pest of amaranthus and is widely distributed in India. It attacks both wild and cultivated amaranthus, especially the leafy varieties with large leaves. Hence, management involves destruction of unwanted, weedy wild amaranthus plants, to reduce the breeding place for the weevil. Adults are ash-grey in colour, with elbowed antennae and brown elytra. Females lay eggs singly in holes made on the stem, branches, petioles or midribs. Eggs are smooth, oval and pale yellow in colour. Incubation period is 3 to 8 days.

5.1 Seed back up programs

In hybrid breeding program, testing of new hybrid combinations is a continuous process and in most cases, the availability of crossed (hybrid) seed for their annual evaluation of selected hybrids is an important issue. Since, the selection of hybrids for advancement is based on yield data, one year will be required to produce seed for testing in the subsequent season. This means for each cycle of advancement, one valuable season will be consumed in their seed production. To avoid this situation and enhance the testing program at a fast pace, an aggressive hybrid seed production program should be followed. This can be achieved by visually selecting relatively more number of hybrids based on their flowering time, plant vigor, disease resistance, and early pod load about 4-5 weeks before harvesting. During this period, the new seed of the selected hybrids can be produced manually. This operation is facilitated by the perennial nature of pigeonpea plant, which can flower for extended periods of 40-50 days; that allows completion of desired number of pollinations of the target crosses in the same cropping season. One trained person can pollinate about 300 buds in 6-7 hours; and with 20% success, about 150 seeds can be produced. Experience has shown that, with good planning and crop management, this program can be achieved with ease.

Inflammation of the joint is known as arthritis.
Coxitis : Inflammation of hip joint.
Gonitis : Inflammation of stifle joint.
Omarthritis : Inflammation of shoulder joint.
Carpitis : Inflammation of carpal joint.

Crossandra

Crossandra (Crossandra undulaefolia) is one of the important commercially grown flower crop in Tamil Nadu. In recent years there is a marked decline in the cultivation of this crop in Madurai, Dindigul, Coimbatore, Salem, Thiruvannamalai and Tiruchirappalli districts. The common problem with the crop is death of plants in patches during the second and third year. This is due to the nematode-fungal complex disease in the crop.

Investigations revealed the association of root-knot nematode, Meloidogyne spp. and the root-lesion nematode, Pratylenchus delattrei with the crop along with fungal patheogen, Fusarium solani.

Root-knot nematode

Both M. incognita and M. javanica are reported to cause damage and yield loss to the crop. The affected plants exhibit stunted growth, yellowing of leaves and also have chlorotic symptoms. The nematode in association with R. solani causes serious damage to the crop. The infested plants show root galls.

The quantitative increase in plant body such as increase in the length of stem and root, the number of leaves etc., is referred to as plant growth whereas, the qualitative changes such as germination of seed, formation of leaves, flowers and fruits, falling of leaves and fruits is referred as development. Utilization of these substances for proper development of the plant is regulated by certain chemical messengers called plant growth substances or plant growth regulators, which in minute amounts increase or decrease or modifies the physiological process in plants. Plant growth substances are the chemical other than nutrient which required in very small amount but without which plant can not complete their physiology.

The two sets of internal factors, viz., nutrition and hormone control the growth and development of the plant. The raw material required for growth is supplied by nutritional factors which include the minerals, organic substances the protein, carbohydrates, etc.

Phytohormones: These are the hormones produced by plants which in low concentrations regulate plant physiological process. These usually move within the plants from a site of production to a site of action.

Plant growth regulators: These are organic compounds other than nutrients, which in small amounts promote, inhibit or otherwise modify any physiological process in plant.

It may be defined as any organic compounds which are active at low concentrations (1-10 ml) in promoting, inhibiting or modifying growth and development in plants. The naturally occurring (endogenous) growth substances are commonly known as plant hormones, while the synthetic ones are called growth regulators.

Plant hormones: It is an organic compound synthesized in one part of plant and translocated to other parts, wherein very low concentration causes a physiological response.

The plant hormones are identified as promoters (auxins, gibberellin, and cytokinins), inhibitors (abscisic acid and ethylene) and other hypothetical growth substances (Florigen, death hormone, etc.).

9.1. Nutrient deficiency of corrective measures

9.1.1. Major and secondary nutrients

The problematic areas for crop production may be soils affected with acidity, high concentration of salts, water logged soils or soils in steep sloppy areas. These soils have limitations or ill effects for crop growth and productivity.

Emergency medicine deals with patients those are critically ill and requires immediate healthcare for survival. Every life threatening disease is presented
for emergency management and the clinician is required during emergenices to successfully manage these with strong working knowledge, quick assessment
and appropriate action.

In this chapter, we explore Latin square design (LSD), a specialized form of experimental design renowned for its efficiency in controlling variation. This chapter thoroughly discovers the foundational principles, structure, and application of LSD in experimental research. It details mathematical models for LSD and guides readers through the interpretation of ANOVA tables. Furthermore, the chapter provides a systematic approach to conducting LSD analysis using R software.

Latin Square Design

The LSD is a statistical design used extensively in experiments, especially when specific conditions are met:

• Controlled variation in two directions: LSD is particularly suited for experiments where variation can be controlled along two different factors. This design structures the experimental units into a square matrix, allowing two sources of variability to be accounted for.

• Adherence to experimental design principles: Like other designs, LSD follows the key principles of randomization, replication, and local control. Randomization in LSD is applied within the rows and columns of the square matrix, ensuring unbiased treatment comparisons.

• Efficient use of resources: LSD allows for an effective utilization of resources by controlling two variables simultaneously. This makes it a more efficient design compared to RBD or CRD when there are two sources of nuisance variables.

Women play a crucial role in agriculture worldwide, contributing significantly to food security, economic stability, and community development. Despite their essential role, female farmers face numerous challenges, including limited access to land, credit, education, and technology. This article explores the multifaceted contributions of women in agriculture, the barriers they face, and the strategies for empowering female farmers. By addressing these challenges through targeted interventions and policies, we can enhance agricultural productivity, promote gender equality, and achieve sustainable development goals.

Introduction

Women are indispensable to the agricultural sector, particularly in developing countries where they make up a substantial portion of the agricultural labor force. Their roles range from fieldwork and livestock management to food processing and marketing. However, female farmers often encounter systemic barriers that hinder their productivity and limit their potential. Empowering women in agriculture is not only a matter of social justice but also a critical factor in boosting agricultural output, improving food security, and fostering sustainable development.

Abstract

In Himachal Pradesh, apple plantations have been made on seedling rootstock. The valley and comparatively warmer areas leads to the problems of irregular bearing and lower yields, besides less colour development in delicious varieties. Non uniformity in tree growth and yield is observed. To solve these problems, efforts have been made and plants of different cultivars of delicious and other prominent cultivars on different virus free clonal rootstocks have been introduced and planted at progeny-cum-demonstration orchard (PCDO) at anu situated at 1375m a.m.s.l. in Shimla district during 1989-90. Plant of three cultivars viz., Real Mecoy Red Delicious, Mutsu and Criterion on EMLA 26, EMLA 7a and EMLA 106 rootstock have been planted with a density of 1280 plants per hectare. The observations on yield were recorded during 1999-2002.

•    A corn plant requires a certain number of growing degree units (GDUs) to reach maturity, regardless of the number of calendar days it takes to accumulate.
•    The relationship of GDU accumulation and corn development, along with utilizing the estimated number of days to reach a certain growth stage, can help predict when important growth stages will occur.
•    Growth stages can be used to help growers make timely applications of herbicides and fungicides. The following information is on corn growth and development from emergence to R6 growth stage.
•    Corn growth stage development can vary according to corn maturity. An early maturing product may produce fewer leaves or develop through growth stages faster than a slower paced late maturing product. This is important to remember when staging corn in relation to accumulated GDUs.

Plants are responsible for highly useful molecular reactions. All the enzymatic  reactions  that  occur in the cell are  termed  as metabolic reactions.  They  take place within organisms in an orderly and regulated way.  They  are  the  metabolic pathways and the compounds  resulting from the process, namely,  metabolism are called  the metabolites. Metabolism in Greek means change. It is the set of life sustaining chemical transformations within the cells of living organisms. These enzyme-catalyzed reactions allow organisms to grow and reproduce, maintain their structures, and respond to the environments around them.
 
Metabolism is a highly organized,   coordinated and purposeful enzymatic activity inside a cell. Metabolism has four functions: 1. To obtain energy from the environment, 2. To convert molecules into building blocks, 3. To convert the building blocks into proteins, lipids, sugars, nucleic acids and other cell components and 4. To synthesize and degrade organic molecules for specific needs of the cell.