eChapters

Effective application of pesticides depends on many factors. One of the more important is to correctly calculate the amount of material needed. Unless you have the correct amount of pesticide in your tank mix, even a correctly calibrated sprayer can apply the wrong rate.

Manufacturers provide application rate instructions on every pesticide label. Due to the variety of ways in which these recommendations are stated (such as lbs. of active ingredient (a.i.) per acre, lbs. of formulation per 100 gal. of spray, or ozs, of a.i. per 1,000 sq. ft.) it is often necessary to adapt the recommendations to different areas and volumes, or even other units. Sometimes the amount of active ingredient must be converted to the amount of actual product. This process can be very confusing.

2.1 Introduction
As time passes, the customers are used to the practice of having short life for the products, which they buy and use. This is because of the globalization of business and growing global competition all over the world. The companies engaged in manufacturing and selling the products which are used at large volume by households and partly by industries, introduce new models to attract customers and to have more market share. This in turn has impacts on customer buying and retention decisions of those products. Though the companies introduce new models, they are expected to keep the prices of the products at affordable ranges so that there is always a larger customer segment to buy those products. This is like egg or chicken situation, because companies introduce many new models to out beat competition and in turn customers expect improved versions of those models in shorter time intervals. This forces companies to continuously engage themselves to come out with new models or improved models which have convergence of technologies to give maximal customer satisfaction. So, creativity in product design becomes an essential requirement of the product development teams of the companies.
2.2 Product Design
Product design aims to include the following tasks to solve the problems of the users or address expected needs of customers in a given market. These tasks are human intensive.
i. Understanding end-users’ requirements
ii. Imagining alternate product ideas to address their needs

Introduction

Impact of WTO or Globalization of Indian agrarian sector claims to extend benefit of trade even to widely spread villages. In India, a sizeable number of rural masses are self-employed and able to produce what is needed just for their livelihood. They cannot be brought into market exchange relationship. So, there is every possibility of their being deprived of expected benefits. Globalization, rather, will widen the disparity between who are associated with market and who are not. Developed countries seem to have held globalization as a powerful weapon in their hands. They are stressing on opening up of national boundaries for movement of their goods and capital to developing countries but they are putting lot of restrictions on technology and labour movement, which can be far more beneficial to developing countries.

5.1 Introduction

Rainfed agriculture accounts for about 60-95% of farmed land in major areas of the world covering Saharan Africa, Latin America, North Africa and East Asia and South Asia. Agriculture in about 60 percent of 142 m ha of net cultivated area in India is rainfed without access to any source of irrigation. Rainfed agriculture is mostly practiced in arid, semi-arid and sub-humid regions where the rainfall is low in quantity, erratic in distribution and is also characterized by high inter-year variability. Together with poor and degraded soils, this limits the length of growing season as well as the choice of crops that can be grown sustainably. Coarse cereals, pulses, oilseeds and cotton dominate the cropping pattern in the regions where rainfed agriculture is concentrated. More importantly, these rainfed regions provide a livelihood to a majority of the rural poor, and as a result they are often described as concentrations of mass poverty and hotspots for civic strife. The productivity of crops grown in rainfed areas is considerably lower than its potential and much lower than that of irrigated crops. Enhancing the productivity of rainfed crops is therefore important from the viewpoints of growth, equity and sustainability.

23.1 Introduction

Cultural methods have been in practice for pest management in traditional systems of agriculture since time immemorial. The worldwide awareness of safe environment provided the impetus to foster non-chemical pest management strategies. Of these strategies, cultural control constitutes the most farmer-oriented approach, where the weak points in the biology and behaviour of insects are exploited and pressure is exerted on the population by manipulating the environment.  In addition to the cultural practices, the other widely used approach is the use of physical control methods which hold promise and provide an attractive alternative to current practices, particularly when integrated into a general control scheme incorporating cultural methods, plant breeding, biological or behavioural methods and pesticides. In physical control methods, the physical environment of the pest is modified in such a way that the insects no longer pose a threat to the agricultural crop.

Introduction

The concept and impetus for IPM grew out of the discontent with using a purely insecticidal approach to insect control in many areas in the mid of twentieth century. Excessive use of pesticide and growing needs of people has triggered several consequences such as resistance and resurgence of pests, destruction and elimination of natural enemies, effect on non target organisms, environmental pollution, disruption in food cycle and food web and residues in food commodities and pesticide poisoning. Less knowledge about biocontrolagents/natural enemies and their non-availability at right time is the key hurdles for farming communities to adopt the IPM practices on their farm. However, pesticides are still a significant component of many control programs and their negative environmental and health impacts have stimulated the research to develop alternate pest management strategies, such as biological control (BC) and other compatible, safe and sound control practices. Some remarkable early successes for both the control of insect pests and weeds (e.g. the cottony cushion scale Icerya purchase (Maskell) by the vedalia beetle Rodolia cardinalis (Mulsant) in California; the prickly pear cactus Opuntia stricta (Haw.) by the moth Catoblastis cactorum (Berg) in Australia certainly were an impetus for further research in BC field. Although the levels of success have been variable, biological control is still considered as an important means of pest control, either alone or as component of integrated management programs (Jervis, 2005; Wajnberg et al., 2007).

Introduction

According to research released not too long ago by the United Nations, the population of the entire planet is expected to reach around 8 billion by the end of the year 2022. As a consequence, the future demand for the production and distribution of food must be satisfied to provide sustenance for the expanding population of the world and to alleviate human suffering. However, in countries like India, food is wasted at an alarmingly high rate every year because there are insufficient facilities for cooling and storing food once it has been harvested. The majority of the losses began on the farm level since the fresh produce, which requires fast refrigeration after harvest in large quantities, was unable to be given, which led to the spoilage of the food. It is especially vital to shorten the amount of time between harvesting and first cooling to slow down the rate at which newly harvested fruits and vegetables breathe out carbon dioxide and exhale it. When keeping fresh fruits and vegetables, the two most important controlling parameters are temperature and relative humidity. These two factors work together to minimize the amount of water that is lost and to keep the product quality from deteriorating. Following their preferred ranges of temperature and relative humidity, fruits and vegetables can be divided into the following categories: (Table 15.1). For the objectives of on-farm cooling, the majority of fresh fruits and vegetables that are classified as belonging to groups 1 and 2 need to be concentrated, which necessitates maintaining an ideal temperature of less than 10°C and a relative humidity of more than 90%.

Deep learning enables automated analysis of agricultural images for crop classification, disease detection, weed identification, yield prediction and soil monitoring. This chapter examines Convolutional Neural Networks, Recurrent Neural Networks and Vision Transformers applied to imagery collected by satellites, drones and ground-based sensors. These models automatically identify patterns and features that conventional methods may overlook. Integration with precision agriculture can improve decision-making, increase crop productivity and reduce resource waste. Challenges include shortages of annotated datasets, limited interpretability and high computational requirements. Transfer learning, data augmentation, edge computing and real-time processing are discussed as approaches for enabling practical deployment in remote and resource-constrained agricultural environments.

Disease in plants defined as the series of invisible and visible responses of plant cells and tissues to a pathogenic organism or environmental factor that result in adverse changes in the form, function, or integrity of the plant and may lead to partial impairment or death of plant parts or of the entire plant.

A pesticide is any material intended to prevent, destroy, repel, or mitigate any pest, which is defined as a living organism that occurs where it is not wanted or that causes damage to crops, humans, or other animals. There are many different types of pesticides, each is meant to be effective against specific pests. The term “-cide” comes from the Latin word “to kill.”

Introduction

In the last two decades, sustainable agriculture has grown to become one of the most pressing issues in agriculture. Although there are numerous definitions of sustainable agriculture, most agree on three fundamental overlapping components: Ecological, economic, and social sustainability (Kaur 2013; Pilgeram 2013). Meanwhile, the prevalence of plant diseases is a major impediment to sustainable agricultural production systems worldwide, particularly in the tropics and subtropics. Farmers frequently apply agrochemicals (i.e., pesticides, insecticides, fungicides, herbicides, etc.) over their recommended dose to manage plant diseases, raising serious concerns about food safety, soil, environmental quality, and pesticide resistance (Dordas 2008; Kaur 2013).

Disease detection on plants is critical for sustainable agriculture, and manually monitoring plant diseases is difficult. It usually requires a significant amount of work, knowledge of plant diseases, and extended processing time. Early detection is the base for efficient plant disease prevention and control, and it is critical in agricultural production management and decision-making. Plant disease identification has become increasingly important in recent years (Li et al., 2021). Diseased plants usually have visible marks or lesions on their leaves, stems, flowers, or fruits. In general, each disease or pest condition has a distinct visible pattern that can be used to identify abnormalities. Typically, the leaves of plants are the primary source for identifying plant diseases, and most disease symptoms may first appear on the leaves (Ebrahimi et al., 2017). Rapid advances in biotechnology have resulted in the development of various molecular diagnostic tools over the last decade. These tools, which are based on the properties of nucleic acids (DNA or RNA) or proteins of the target agents, have improved the efficacy, accuracy, and speed of detecting and identifying disease-causing agents, as well as the characterization of a wide range of pathogens and pests. Various techniques are used in biotechnology for disease diagnosis and management, but molecular markers are used in particular for the detection, identification, quantification, and characterization of plant pathogens that cause diseases in plants (Kumar et al., 2015).

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

Insects generally reproduce by laying eggs or ‘ova’. The initiation of growth inside an egg, which in most cases is preceded by fertilization, leads to a long series of changes, finally attaining the adult stage and in due course to sexual maturity and finally to reproduction of a new generation. This chain of events from the egg stage to adult constitutes the ‘life history’ or ‘life cycle’ of an insect.

The digestive system of insects comprises of two main sub-parts, one is the alimentary tract or also known as the digestive tract and the associated digestive glands. These digestive glands may be associated directly or indirectly such as, salivary glands, gastric, caeca (directly) and Malpighian tubules (indirect). If we have to describe an insect and its anatomy, or its histology, it is based on the orthopteroid plan, which is mostly shown by grasshoppers, crickets, and locusts, because their plan shows and describes the basic, primitive design from which other groups of insects have enolved and showed modifications and specialization. We can say that this orthoptera insect shows the general anatomical and histological features of a generalised insect.Today, we see that insects have invaded and adapted in almost all types of habitats and the major reason for their biological success is their ability to show digestion, utilization and their ability to eat an extremely vast diversity of food. It is due to this abilityof extremizm in food diversity that insects have undergone many specializations and modifications of the alimentary canal. What modifications a species of insects undergoes, depends upon the type of insects, depends upon the type of food it consumes. The diversity is also seen in the way of obtaining, storing, processing and absorbing the food. These differences may be structural or functional or both. It is not necessary that these differences must be present in different species only, those may be shown by different life stages of a single insect, by two sexes of a single species, etc. e.g., the difference between the mouths parts of mosquito species.

Alimentary canal of an insect is a tubular structure passing through the body that provides the special internal environment for the food to be mechanically and chemically disintegrated and brought to the vicinity of absorbent cells. Hence, it is involved in the transport of nutrients to the individual cells. It is concerned with ingestion, trituration (chewing), digestion, absorption of nutrient material into haemolymph and egestion of unused food materials. It is tubular structure, which extends from mouth to the anus. It is divided into three distinct regions, namely fore-gut (stomodaeum), mid-gut (mesenteron) and hind-gut (proctodaeum). The fore- and hind-guts are ectodermal in origin and the mid-gut is endodermal.

Longitudinal and circular (intrinsic) muscles are usually associated with each of these three regions and by means peristaltic contractions move the food along the alimentary canal. The functional stomach is the mesenteron usually a circular valve-like fold separates the cavities between stomodaeum and mesenteron is known as stomodael or cardiac valve, and the one closing the entrance to the proctodaeum as the proctodaeum or pyloric valve.

Fore-gut

An insect’s mouth, located centrally at the base of the mouthparts, is a muscular valve (sphincter) that marks the “front” of the foregut. Food in the buccal cavity is sucked through the mouth opening and into the pharynx by contractile action of cibarial muscles. These muscles, located between the head capsule and the anterior wall of the pharynx, create suction by enlarging the volume of the pharynx (like opening a bellows). This “suction pump” mechanism is called the cibarial pump. It is especially well-developed in insects with piercing/sucking mouthparts.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Pesticide Dusting

The dusting powders are low concentration ready to use type, dry formulations containing 2 to 10% pesticide. The inert material or dry diluents is talc, soapstone, attapulgite, etc. and it is non toxic. The sulphur dust is not diluted with inert material.

Introduction

Horticulture is an intensive but profitable venture with higher output in terms of yield and income per unit area and time. In order to maximize the output, there has been liberal use of inorganic products like fertilizers, pesticides (insectides, fungicides, nematicides, weedicides) and other chemicals. With the continuous application of these chemicals since the last green revolution, the soil and its fertility is showing the sign of fatigue and plants developing resistance to insects, pests and diseases is breaking down and causing overall pollution to soil and water. There is growing evidence of sterility in humans and various other animals, particularly in males, related to the presence of various chemicals and pesticides in the environment. Hence the demand of the hour is looking for some alternative arrangements which are eco-friendly and moreover safe guarding the quality of the produce, which is essential so far as ornamentals are concerned. This is especially true for cut flowers and potted plants. Visible symptoms of insects, pests and diseases, have a major impact on quality. Direct and indirect effects of infections include reduction in growth, reduction in vigor, costs of attempting to maintain crop health, reduction in quality and/or market value (Hadidi et al., 1998). This may cause serious economic losses. In addition, infected plant material may not be acceptable for export.