eChapters

The complete system of veins of a wing is termed venation or neuration. Generally in all the insects, there is some similarity in wing venation and therefore, it is presumed that all types of wing venation have developed from the common base or the same ancestor. Using an extensive study of wing venation in different groups of insects, Comstock and Needham constructed a hypothetical type of wing venation from which all other types have presumably been derived. According to them the primitive wing venation has developed from two tracheae which are situated on the anterior and the posterior basal margins of wings and their branches are spread all over the wing.

Metamorphosis and immature stages

The change in growth and development (form) of an insect during its life cycle from birth to maturity is called metamorphosis. There are four basic types of metamorphosis in insects.

Ametabola: (No metamorphosis) e.g. Silver fish.

These insects have only 3 stages in their life cycle namely egg, young ones and adults. It is most primitive type metamorphosis. The hatching insects resemble the adult in all respects except for the size and called as juveniles. Moulting continues throughout the life.

Hemi-metabola: (Incomplete metamorphosis) e.g. Dragonfly, damselfly and may fly.

These insects also have 3 stages in their life namely egg, young ones and adults. The young ones are aquatic and are called naiads. They are different from adults in habits and habitat. They breathe by means of tracheal gills. In dragonfly naiad, the lower lip (labium) is called mask which is hinged and provided with hooks for capturing prey. After final moult, the insects have fully developed wings suited for aerial life

The best learning situation requires one specimen and set of tools per two students for studies. Students working in pairs have ample opportunity to fully participate in the dissection and to carefully examine the specimen. They are also able to share and discuss their observations during and after the dissection.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Pull the cut sides apart and observe the internal organs. Pin the sides of the insect to the dissecting pan. The observation of the reproductive systems of males and females are as follows:

Female reproductive system

The main functions of the female reproductive system are egg production and storage of male spermatozoa until the eggs are ready to be fertilized. The basic components of the female system are paired ovaries, which empty their mature oocytes (eggs) via the calyces (Calyx) into the lateral oviduct which unite to form the common (median) oviduct.

Requirements: Agriculturally important insects of each order

 Orthoptera

 Examples: Grasshopper, cricket, etc.

Metamorphosis: Paurometabolous

Mouthparts: Chewing

 Significance: Variable or Pest

 Characteristics

 •            They are medium to large-sized insects.

 •            Antenna is filiform.

 •            Mouthparts are mandibulate.

 •            Prothorax is large. The pronotum is curved, ventrally covering the pleural region.

•             Hindlegs are saltatorial

 •            Forewings are leathery, thickened and known as tegmina.

 •            They are capable of bending without breaking.

 •            Hindwings are membranous with large anal area.

 •            They are folded by longitudinal pleats between veins and kept beneath the tegmina.

Requirements: Insecticides of different types

Insecticide chemicals in their “raw” or unformulated state are not usually suitable for pest control. These concentrated chemicals and active ingredients may not mix well with water, may be chemically unstable, and may be difficult to handle and transport. For these reasons, manufacturers add inert substances, such as clays and solvents, to improve application effectiveness, safety, handling, and storage. Inert ingredients do not possess Insecticidal activity and are added to serve as a carrier for the active ingredient. Manufacturers will list the percentage of inert ingredients in the formulation or designate them as “other ingredients” on their labels.

Sprayers

Sprayer is a machine used to apply liquid chemicals on plants to control pest and diseases. It can also be used to apply herbicides to control weeds and to spray micro nutrients to enhance plant growth. The main functions of a sprayer are

•             Breaking the chemical solution in to fine droplets of effective size.

 •            Distributing the droplets uniformly over the plants.

 •            Applying the chemicals with sufficient pressure for positive reaching the plants

 •            Regulating the amount of liquid applied on plants to avoid excessive application.

Requirements: Clipboard, Pencils, Hand lens, Pocket knife, insect catching nets, attractants, spread sheet Collection bags and vials, Camera etc.

Sampling techniques are used to draw valid inferences about the population parameters using the sample statistics

Components of an insect sampling program 

Knowledge of pest and beneficial insects

Identification

 Life cycle and biology

Injury caused

Sample: Sample is a subgroup of the population. It is defined as a collection of individual observations from the population about which inferences are to be made, and is obtained by a specific method.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Polymerase Chain Reaction (PCR) is a laboratory technique, developed by Kary Mullis in the 1980s, used in molecular biology to amplify and replicate a specific segment of the DNA (Mullis, 1990). This reaction in performed in a thermal cycler, involving three main steps: denaturation, annealing and extension.

Principle: PCR is based on the principle of selectively amplifying a specific region of DNA through a series of temperature-controlled cycles. The key components involved in PCR include the target DNA sequence, oligonucleotide primers, DNA polymerase enzyme (Taq DNA polymerase), deoxyribonucleotide triphosphate (dNTPs) (A, T, G, and C), Mg2+ and a thermal cycler apparatus. Initially, the double-stranded DNA is split into single strands under high temperature of 90-95 0C known as the denaturation step. It is followed by cooling the solution to a temperature that allows proper attachment of the oligonucleotide primers to its complementary sites in the strands, known as the annealing step.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface.

Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane.

1. Preparation of tissue homogenate

The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

1. Introduction

Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

Introduction

Regenerative agriculture is both a philosophy and a strategy for land management. It asks us to consider how all aspects of agriculture are connected through a web, which is a network of entities that grow, enhance exchange, and distribute, consumer products and services. Traditionally, supply chains have been organized linearly. It is about farming and ranching in a way that nourishes people as well as the earth, with specific practices differing from grower to grower and from region to region. This style of farming and ranching is also known as “permaculture.” Although there is no definitive rule book, the holistic principles that underpin the dynamic system of regenerative agriculture are designed to address issues of inequity, reestablish the health of soil and ecosystems, and ensure that our land, waters, and climate are in better condition for future generations. It is a novel concept of uplifting the natural world rather than imposing an invasive control, regenerative agriculture intriguing environmental approach to agricultural production that enables the natural systems to renew themselves. Regenerative agriculture refers to farming practices that, in comparison to industrial agriculture, cause significantly less damage to the surrounding environment and the soil. When we give more to nature than what we receive from it, we bring nature closer to us and bring ourselves closer to nature at the same time. Farming that is in harmony with both the surrounding environment and the community fosters a feeling of integrity and togetherness that helps to strengthen the connection between the two. The concept of harmonious farming can be summed up in a few words: It involves engaging in agricultural practices and cropping systems that increase soil fertility return nutrients to the soil, increase soil water retention, remove carbon dioxide (CO2 ) from the atmosphere, and, most importantly, adapt to the ecosystems in which they are grown.

Introduction

The term “Integrated Farming System (IFS)” (or simply “integrated farming”) is a term used frequently and generically to describe a method of farming that is more integrated than monoculture methods. By virtue of the intensification of crops and related industries, an IFS offers the chance to enhance economic yield per unit area per unit time. This is accomplished through the system’s use of several crop rotations. It improves the efficiency of fertilizers and natural resources, improves the recycling of nutrients, and contributes to increased food security. The IFS technique promotes ecological intensification by lowering the amount of anthropogenic inputs while simultaneously enhancing the performance of ecosystem services such as the recycling of nutrients, the creation of soil, and the soil’s fertility. IFSs that are well- managed are seen to be safer than those that are not because they benefit from synergy among businesses, diversification of crops, and ecological stability (Behera et al., 2015). It requires paying attention to the minute details and constantly striving to improve in all facets of agricultural production through well- informed administrative practices. The IFS approach is widely regarded as the most important strategy for enhancing the nutritional status of families and ensuring the viability of their livelihoods. The research strategy that is centered on crops and cropping systems needs to give way to the research strategy that is based on agricultural systems, especially for smaller farms (Jha et al., 2011). Recycling of waste and increased effectiveness in terms of land utilization are two essential components of the IFS. The components and enterprises that make up the IFS might differ from region to region. This is because agroclimatic conditions, such as the kind of land, the availability of water, the socioeconomic standing of farmers, and market demand, all play a role. For effective holistic agricultural systems to be constructed, there must be strong connections and complementarities between the various components (Bell et al., 2014). Integrating land- based businesses into the biophysical and socio- economic contexts of farmers, such as aquaculture, poultry, duckeries, apiaries, as well as field and horticultural crops, is essential in the IFS to make farming highly profitable and reliable (Behera et al.,2004: Kashyap et al., 2015). Farmers who are limited in their access to resources can achieve sustainable output through the careful administration of agricultural residues and the distribution of limited resources

Introduction

The problem of dealing with climate change, a critical global issue, has come to define our era. Human activities are rapidly altering Earth’s climate, with far- reaching repercussions for many industries, including agriculture. The necessity for environmentally responsible food production is pressing as the global population rises. One possible way to lessen the effects of global warming on food production is to adopt the sustainable agriculture practice of striking a balance between environmental protection, social justice, and economic viability. The impacts of climate change on farming may be seen all across the world right now. Global food security is threatened by climate change, which is causing higher temperatures, changing precipitation patterns, and increasing extreme weather events. Greenhouse gas emissions, deforestation, and unsustainable farming practices all have a hand in accelerating global warming. Therefore, it is crucial to tackle the double problem of lowering agriculture’s environmental imprint while also adapting it to climate change. Sustainable agriculture works toward a compromise by encouraging robust and flexible agricultural practices. It aims to ensure the sustainability of food production in the future while reducing environmental effects by incorporating climate change adaptation and mitigation techniques into agricultural practices. Agricultural systems can be made more resistant to climate change by the use of sustainable farming practices such as agroforestry, crop diversification, soil conservation, and water management. Sustainable farming practices help communities adapt to climate change, boost local economies, and secure food supplies for future generations.