eChapters

The diffusion and adoption process represents a fundamental mechanism through which innovations, practices, and ideas spread through communities and social systems, making it essential for understanding how community mobilization initiatives can expand their reach and impact while building sustainable social change that extends beyond initial implementation sites. This process encompasses the complex social, psychological, and institutional factors that influence how individuals and communities learn about new approaches, evaluate their potential benefits and risks, and ultimately decide whether to adopt and integrate these innovations into their existing practices and belief systems. Understanding diffusion and adoption processes provides community mobilization practitioners with crucial insights into how successful interventions can be scaled up and replicated across different contexts while identifying the factors that facilitate or hinder

In the present investigation, nine cyanobacterial species viz. Anabaena variabilis, Anabaena fertilissima, Nostoc muscorum, Nostoc punctiforme, Nostoc linckia, Nostoc commune, Spirulina platensis, Westiellopsis prolifica and Hapalosiphon sp. were tested for their activity pattern against some selected bacterial species.
 
Each cyanobacterial species was initially subjected to determine the early stationary phase of their life-cycle, which is believed to be the most appropriate period for the production of secondary metabolites by an organism. The growth curve for each cyanobacterial species was prepared by culturing them in BG-11 growth medium. Optical densities (OD) recorded at 650 nm were plotted against number of incubation days for each cyanobacterium. After 23-25 days of incubation period, each culture was harvested to obtain the biomass and spent medium, which were then subjected to process of extraction by using various solvents viz., Hexane, ethyl acetate, dichloromethane and methanol. The extracts and spent medium thus obtained were then investigated for antibacterial activity against five pathogenic bacteria including Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pnumoniae and Salmonella typhi.

Introduction

Biological nitrogen fixation (BNF), generally found in legumes, is a valuable nature’s gift through which atmospheric nitrogen is fixed by symbiotically associated rhizobia that make it available to plants. Among cereals, rice (Oryza sativa) is an important staple food crop that feeds a large proportion of the world population [1]. There is tremendous pressure on agriculturists worldwide to increase the yield to meet growing consumption to feed a world population increasing day by day. However, unlike symbiotic plant–microbe interactions commonly observed in legumes, in several cereal crop plants including Oryza sativa, endophytic associations have been observed [2-8].

Soil is a bioorganic - mineral complex of the loose surface layer of the earth’s crust. Soil microbiology is the science that deals with the millions of microscopic forms of life found in the soil. It is stated that one hectare - foot (one hectare to a depth of 30cm) contains 2 to 10 metric tons of living microorganisms. Soil microorganisms are in a constant struggle for existence and are believed to be in a state of dynamic equilibrium. Without microorganisms, the soil would be an inactive geological mass incapable of supporting plant life and without plant life, animal life would not be possible. This soil population consists mainly of bacteria, fungi, actinobacteria, algae, and protozoa. The soil ecosystem includes these microbial groups as well as the inorganic and organic constituents of a given site. The collections of cells represented in the community are considered as distinct populations. All the inhabitants of the particular locality make up the community.

Types of Microorganisms in Soil

Living organisms both plants and animals, constitute an important component of soil. The pioneering investigations of several early microbiologists showed for the first time that the soil was not an inert static material but a medium pulsating with life. The soil is now believed to be a dynamic or rather a living system, containing a dynamic population of organisms/microorganisms. Cultivated soil has relatively more population of microorganisms than the fallow land, and the soils rich in organic matter contain much more population than sandy and eroded soils. Microbes in the soil are important to us in maintaining soil fertility and productivity, cycling of nutrient elements in the biosphere, and sources of industrial products such as enzymes, antibiotics, vitamins, hormones, organic acids, etc. At the same time certain soil microbes are the causal agents of human and plant diseases.

Globally, 2 billion children under the age of five suffer from diarrhoea, of which, more than 50% of the cases being in South Asia and sub-Saharan Africa, where the disease is more likely to be fatal (UNICEF-WHO, 2009). It has been also estimated that the great majority of acute diarrhoeal illnesses in children over the age of two years is attributable to bacterial pathogens (Carpenter, 1980). Amongst the various enteric bacterial pathogens, diarrheagenic strains of Escherichia coli are considerably responsible for causing bacterial diarrhea (Nataro and Kaper, 1998).

Many microbes have ability to attach to various surfaces forming three dimensional extracellular matrix within which embedded the microbes grow and multiply forming thin layer structure called biofilm. Biofilms may form on living or non-living surfaces and can be prevalent in natural, industrial and hospital settings (Hall-Stoodley et al., 2004). Biofilm mainly consist of three components - bacteria, matrix and surface. Extracellular matrix generally composed of extracellular polymeric compounds such as extracellular polysaccharides, proteins, phospholipids, DNA, teichoic and nucleic acids, and other polymeric substances hydrated to 85 to 95% water and polysaccharides (Hall-Stoodley et al., 2004).

Abstract

A field study of seven arid districts of Rajasthan was undertaken to evaluate the occurrence of selected tree species and arbuscular mycorrhizal fungal (AMF) associations with them. Five genera were identified in the rhizosphere of these selected tree species. A high diversity of AMF was observed which varied between different host tree species. Among the five genera, Glomus occurred most frequently, with four species, Acaulospora and Gigaspora were found with three species, while Entrophospora and Scutellospora was detected with two species. Gigaspora margarita, Gigaspora rosea, Glomus deserticola, Glomus constrictum, Glomus fasciculatum, Glomus mosseae and Scutellospora calospora were the most dominant species. The AMF spore density was not clearly affected by the host tree suggesting that biotic factors may be relatively less important than abiotic/edaphic factors for establishing population pattern. The spore density of AMF had a strong positive correlation with soil pH and organic carbon content and a negative correlation with Olsen’s P content of the soil. The association with AMF of these tree species native to the harsh environmental conditions of the Indian Thar Desert may play a significant role in the re-establishment and conservation of these multipurpose desert tree species.

Mastitis is a global problem as it adversely affects animal health, quality of milk and economics of milk production. Bovine Mastitis is reported to be the most costly disease of dairy cattle, causing huge economic losses in terms of reduced milk yield, milk discard after treatment, cost of veterinary services and premature culling. While reviewing status of mastitis in India, subclinical mastitis is more important (10–50%) than the clinical mastitis (1-10%). Estimated annual economic losses incurred due to mastitis estimates to Rs.7165.57 crores to dairy farmers (Bansal and Gupta, 2009).

Abstract

Nematodes are non-segmented worms typically 50 µm in diameter and 1 mm in length. Those few species responsible for plant diseases have received a lot of attention, but far less is known about the majority of the nematode community that plays beneficial roles in soil. Nematode diversity tends to be greatest in ecosystems with the least disturbance. Species of Aphelenchoides, Ditylenchus spp, Helicotylenchus, Meloidogyne spp., Pratylenchus, Scutellonema  and Rotylenchulus are obnoxious plant parasitic nematode beside Heterodera and Globodera. Soil temperature, soil structure, soil pH, soil moisture and soil texture play major role in movement of nematode, infestation and completion of life cycle under abiotic and biotic stresses.

ABSTRACT

Pesticide degradation is the breaking down of toxic pesticides into a non-toxic compounds and, in some cases, down to the original elements from which they were derived. The most common type of degradation is carried out in the soil by microorganisms, especially the fungi and bacteria. Microbial degradation depends not only on the presence of microbes with the appropriate degradative enzymes, but also on a wide range of environmental parameters. Pesticides which are rapidly degraded are called non-persistent while those which resist degradation are termed as recalcitrant (persistent). Microorganisms are able to degrade a large variety of compounds, including pesticides under laboratory conditions. However, methods have yet to be developed to decontaminate the environment from pesticide residues. Continuous efforts are required in this direction, and at present several PGPR capable of degrading pesticides have been isolated from the natural environment. Catabolic genes responsible for the degradation of several xenobiotics, including pesticides, have been identified, isolated, and cloned into various other organisms such as Streptomyces, algae, fungi, etc. In addition, recombinant DNA studies have made it possible to develop DNA probes that are being used to identify microbes from diverse environmental communities with a unique ability to degrade pesticides. Bioremediation treatment still requires more intense research through specific microbial degradation of broad range of organic pollutants. This review describes recent advances in biodegradation of pesticides by addressing the microbes involved in pesticide degradation.

Microbial diversity is the key to human survival and economic well being. It provides a huge reservoir of resources which can be utilized for our benefit. Yeasts have been isolated from many sources for industrial purposes. The impact of yeasts on food and beverage production extends many fold beyond the popular notions of bread, beer and wine fermentations by Saccharomyces cerevisiae.

Diverse dynamic mixed populations of prokaryotic and lower eukaryotic microorganisms govern the fermentation and maturation processes and, finally, impact the quality of wine. Both of these parameters apparently contribute to regional differences in the quality of produced wines and characterization of regional wines should involve the study of microbial populations and their members active in the given region.

UNTIL THE 1940S BIOLOGISTS ARGUED ABOUT WHETHER DNA OR PROTEIN WAS THE MOLECULE OF HEREDITY

Nuclei observed to divide when cells reproduced themselves

Large amounts of both DNA & protein in the nucleus

Many though protein was most likely molecule of heredity

Proteins made of 20 different amino acids- could have more variety than DNA (made of only 4 different bases)

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Objective: To isolate DNA from plant sample by CTAB method and quantification by spectrophotometer.

Background information:

DNA isolation from different plant tissues viz., leaf, stem, root, flower and seed is a challenging task due to hindrance of variety of variety of biochemical compounds present and further problem increases with diverge plant species. In case of animal tissues the diversity in cellular bio-molecules in different species is much lower compared to plants. Two major phyto bio-molecules that have wide variation between species and pose serious problems in DNA isolation are: polyphenols and polysaccharides. These phyto bio-molecules if contaminated in DNA then may hinder further down applications like PCR, restriction digestion, sequencing, etc.

Several methods have been developed and reported that can remove polyphenols and polysaccharides efficiently during DNA isolation from plants. For this purpose two different chemicals are widely used,the first one is CTAB (cetyl trimethyl ammonium bromide) that is a cationic detergent and helps in removal of polysaccharides and the second one is polyvinylpyrrolidone that helps in removal of polyphenols. Due to above properties the CTAB based DNA extraction buffer is very common for plant DNA extraction.

Significance of different types of chemicals found in CTAB based plant DNA extraction method is explained as under:

Introduction

DNA denaturation, also called DNA melting, is the process by which double-stranded deoxyribonucleic acid unwinds and separates into single-stranded strands during the breaking of hydrogen bonding between the bases. Both terms are used to refer to the process as it occurs when a mixture is heated, although “denaturation” can also refer to the separation of DNA strands induced by chemicals like urea. For multiple copies of DNA molecules, the melting temperature (T_m) is defined as the temperature at which half of the DNA strands are in the double-helical state and half are in the “random-coil” states. The melting temperature depends on both the length of the molecule, and the specific nucleotide sequence composition of that molecule.

Applications of DNA Denaturation

The process of DNA denaturation can be used to analyze some aspects of DNA. Because cytosine / guanine base-pairing is generally stronger than adenosine / thymine base-pairing, the amount of cytosine and guanine in a genome (called the “GC content”) can be estimated by measuring the temperature at which the genomic DNA melts. Elevated temperatures are associated with high GC content. GC ratios within a genome are found to be markedly variable. These variations in GC ratio within a genome of higher organisms results in a mosaic like formation with islet regions called isochores. This results in the variations in staining intensity in the chromosomes. The isochores include in them essential protein coding genes, termed housekeeping genes and thus determination of ratio of these specific regions contributes in mapping these essential genesbacterial systematics has recommended use of GC ratios in higher level hierarchical classification. For example, the Actinobacteria are characterised as “high GC-content bacteria”. In Streptomyces coelicolor A3(2), GC content is 72%. The GC-content of Yeast (Saccharomyces cerevisiae) is 38%, and that of another common model organism Thale Cress is 36%. Because of the nature of the genetic code, it is virtually impossible for an organism to have a genome with a GC-content approaching either 0% or 100%. A species with an extremely low GC-content is Plasmodium falciparum (GC% = ~20%), and it is usually common to refer to such examples as being AT-rich instead of GC-poor.

DNA replication. The double helix is unwound and each strand acts as a template. Bases are matched to synthesize the new partner strands.

DNA replication, the basis for biological inheritance, is a fundamental process occurring in all living organisms to copy their DNA. This process is “replication” in that each strand of the original double-stranded DNA molecule serves as template for the reproduction of the complementary strand. Therefore, following DNA replication, two identical DNA molecules have been produced from a single double-stranded DNA molecule. Cellular proofreading and error toe-checking mechanisms ensure near perfect fidelity for DNA replication.

In a cell, DNA replication begins at specific locations in the genome, called “origins”.

Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork. In addition to DNA polymerase, the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other proteins are associated with the fork and assist in the initiation and continuation of DNA synthesis.

DNA Sequencing

DNA sequencing is the determination of the precise sequence of nucleotides in a sample of DNA. Sequencing can be done on a short fragment of DNA to cover the entire genome. The maps thus constructed using the nucleotide sequences in the correct order is called as sequence map.

In 1977, twenty-four years after the discovery of the structure of DNA, two separate methods for sequencing DNA were developed: the chain termination method (Sanger et al., 1977) and the chemical degradation method (Maxam and Gilbert, 1977). Both methods were equally popular to begin with, but, for many reasons, the chain termination method is the method more commonly used today. In chemical degradation method, chemicals specific to each base remove the last base, which has been labelled. The method uses toxic chemicals which required high care while handling.

In chain termination method, DNA polymerase extends a DNA strand in which dideoxynucleotide becomes incorporated terminating the chain extension (phosphodiester formation) at the 3’OH site making an array of fragments differing in length. This method is based on the principle that single-stranded DNA molecules that differ in length by just a single nucleotide can be separated from one another using polyacrylamide gel electrophoresis.