eChapters

Strobilurins are a group of compounds used as fungicides in agriculture. They belong to the larger group of QoI inhibitors that inhibit the respiratory chain at the complex III level.Common strobilurins include azoxystrobin, cresoxime methyl, picoxystrobin, fluoxastrobin, oryzastrobin, dimoxystrobin, pyraclostrobin, and trifloxystrobin.Strobilurin represents an important development of fungal-based fungicides and is derived from the fungus Strobilurus tenacellus.They have an inhibitory effect on other fungi and reduce nutrient competition.They inhibit mitochondrial electron transport, disrupt energy metabolism, and prevent target fungal growth. Strobilurin is the wonder fungicide ever developed with a new MOA and mobility that qualify it as a unique new generation of fungicides controlling different classes of pathogens.

Combination Fungicides

Composite or combination fungicides are made up of two or more active ingredients. The active ingredients of combination fungicides often come from two distinct chemical groups. Combination fungicide products offer an optimized combination of two or more active ingredients and the convenience of one product. Combination fungicides boost each treatment’s efficacy and extend its range of action. Combination products significantly lower pathogen populations by targeting numerous pathogens with a single treatment. Longer periods of control are achieved by further reducing pathogen populations with increased potency. Combinations of fungicides can decrease the selection of pathogen strains resistant to specific fungicides and restrict exposure to each active component.

Crops and trees can be protected from disease by applying pesticides at precisely scheduled intervals. It may only take a few grammes of the chemical to facilitate its distribution over the aerial parts of the plant, or to treat seeds or other propagating organs (tubers, bulbs, corns, etc.) or the soil in which plants will grow. Any chemical can be used in one of four different physical states: gas, solid, liquid, or solution. As a result, it is critical to employ the most efficient equipment to ensure a uniform deposit of the chemical on the target substrate with minimal material waste in the shortest amount of time and with the least amount of manpower.

Common Maintenance

 • Clean the exterior surface with a brush or cotton waste and plenty of water or kerosene oil.

 • Lubricate or lubricate the moving or rubbing surfaces of parts as needed.

 • Filter the chemical solution/fuel oil mixture as it is poured into the tanks. Make the caps or lids leak-proof by using gaskets.

 • Flush the equipment with clean water to clean the insides of containers, tubes, and nozzles.

Care and Maintenance of Hand Sprayer & Duster

• Dusters should be made of dry and sieved dust.

 • Grease the duster gear box once a month.

 • Clean the duster after use by removing all dust from the hopper.

 • Oil the sprayer’s cup and bucket washers on a regular basis.

 • After completing the day’s work, cleanse the spray tank discharge lines and nozzles with clean water.

A problem in the 1970s was the emergence of pathogen strains that were resistant to chemical . Concerns from the public about the effects of agricultural pesticides generally on human health and the environment have grown in the 1980s . A number of pesticides have been deregistered, subject to limitations, or taken off the market as a consequence of this issue.

Because of perceptions rather than actual facts, the use of agricultural pesticides frequently raises serious public concerns. Concerns include the potential for human and domestic animal poisoning, contamination of livestock products, harmful effects on beneficial microorganisms like pest predators and pollinating bees, dangerous residue levels in foods made from sprayed crops, ecological disruption at the level of microorganisms, and the potential for water contamination with subsequent fish loss and residue buildup in groundwater.

Introduction

Plant pathogens can cause significant crop loss both pre- and post-harvest. Fungicides continue to plays an important role in controlling plant diseases caused by fungal pathogens. In the last 100 years, fungicides have evolved from a few simple inorganic compounds to multiple groups of organic compounds, from contact and multisite fungicides to systemic and site specific fungicides with curative properties have evolved. The introduction of new fungicides is an integral part of sustainable disease control in staple crops. The need for new and innovative fungicides is driven by resistance management, regulatory hurdles and changing farmer needs.

India, hitherto reliant on foreign help, is now one of the world’s top producers of food and exporters worldwide. With 330.53 Million Tonnes of foodgrain output predicted for 2022–2023, our nation is a far cry from the 1950s and 1960s. We still behind other developed nations, notwithstanding our gains in production. It is acknowledged that a number of issues prevent Indian agriculture from reaching its full potential. Small land holdings, insufficient irrigation, a lack of technological assistance, and difficult financing access are a few of these. Crop health, however, is a significant obstacle to Indian agriculture that frequently goes unnoticed.

Introduction

The agrochemical sector has been critical in enhancing agricultural productivity and output. Let’s look at the challenges that the agrochemical sector is facing and how they might be solved to ensure a brighter future.

Opportunities

1. Increase in irrigated area: Every year, around 0.5 million hectares of irrigated land are added as a result of the government’s ongoing efforts to make water available for irrigation. This is anticipated to boost production and increase farmer income. As a result, agrochemical consumption is expected to rise.

2. Changing food and consumption trends: Changes in consumption patterns and demand for a wide range of fruits and vegetables may drive farmers to employ more modern agricultural practises in order to fetch a premium for such produce. This segment is predicted to result in a 2% to 3% increase in agrochemical consumption.

Agrochemical Sector is Transforming

Over two lakh crores of India’s agricultural production—roughly 20% of overall production—are lost to pests and diseases. In order to safeguard farmers’ crops in this situation, agrochemicals might be quite important. Even though India uses very little agrochemicals domestically (less than 0.5 kg/ha), it is the world’s fourth-largest producer of agrochemicals.

n the post-COVID era, there is ample opportunity for agrochemicals to emerge as one of the key export sectors capitalising on changes in global supply chains. The government has already identified the agrochemicals industry as one of the 12 Champion sectors to watch, and by 2026, the agrochemicals market is projected to grow to a valuation of around $7.4 billion.

By reducing losses from pests and diseases, the agrochemicals sector contributes significantly to raising agricultural output. In order to meet the challenges of feeding India’s growing population and bringing foreign exchange into the Indian exchequer through the export of high-quality agricultural products worldwide, the prudent use of crop protection chemicals promotes sustainable farm management and offers socioeconomic benefits. Nonetheless, most of the marginalised farmers who are forced to practise subsistence farming are able to produce only enough food to support their family.

It is heartening to see that the Government of India has included the Agrochemicals Industry in the current list of 12 Champion Industries, owing to significant manufacturing for both domestic and foreign markets. Some areas require immediate attention in order to continue growing.

1. Being Independent of China: The Make in India programme should be enforced for many essential agrochemical intermediates, thus becoming China independent.Significant efforts should be made to make this a reality. A well planned, concentrated approach must be developed between the business sec tor and the GOI. Success should be seen within the following two to three years.It is important to emphasise that we can export domestically manufac tured agrochemical intermediates, thereby reducing certain countries’ reliance on China.The agrochemical business would benefit greatly from a level play ing field free of burdensome rules and restrictions, as many of them appear unreasonable.

India’s economic prosperity is reliant on the agriclimate. The nation confronts particular challenges in guaranteeing food security and optimising agricultural yield because of its large and varied landscape. Using fertilisers strategically and sensibly is one of the main reasons Indian agriculture is so successful. Fertilisers are essential for preserving the fertility of the soil, improving crop health, and satisfying the nation’s growing need for food security.

Ensuring Soil Fertility

India’s economy is mostly based on agriculture, with a sizable section of the populace working in the field.However, there are significant regional differences in India’s soil fertility, with certain parts missing essential nutrients for crop growth.

Roughly one-third of the food produced globally is lost or wasted. The India Agricultural Research Data Book from 2004 states that 30% of fruits and vegetables are wasted. Based on an estimated 150 million tonnes of fruit and vegetable output in India, 50 million tonnes of trash are produced annually.

The quality of fruits and vegetables starts to decline as soon as they are removed from their natural source of nutrients. Artificial ripening chemicals are used to speed up the harvesting process, but they also degrade the product and have long-term negative health impacts. Mangoes, for instance, mature rapidly once calcium carbonate is injected into them. Chemicals such as copper sulphate, rhodamine oxide, malachite green, and lethal carbide are frequently utilised to highlight the colour and freshness of vegetables.

Farmers Must Always Get Genuine Products

Since its start, the pesticide industry has supported crop productivity and our agricultural economy. It was crucial in bringing about the Green Revolution. By protecting plants from pests and diseases, pesticides let India’s high yielding types and hybrids reach their full potential for productivity. The Integrated Pest Management (IPM) Programme of the Government of India, state governments, and state agricultural institutes is not complete without the use of pesticides. Farmers will receive value-added solutions from the industry via on-farm demonstrations and on-the-spot knowledge-sharing. The emphasis is on creating plans using chemicals for plant protection and attending to the farmers’ urgent requirements.

Introduction

Our agrarian economy is undergoing amazing changes as a result of the technological and digital revolutions, increased urbanisation, the unprecedented rise in middle income groups, rapidly changing consumer patterns and tastes, and most importantly, as a result of climate change and environmental degradation. As a result of these changes, agriculture now faces both new challenges and opportunities to improve in terms of productivity, economic reward, social justice and inclusivity, and ecological sustainability.

The counterfeiting problem has a significant influence on the agrochemical sector. Over the past few years, spurious agrochemical products have gained market dominance on a global scale.

Drone

Drones are one of the most innovative new technologies to emerge from the fourth Industrial Revolution. Indian farms may be significantly impacted by drone use in pesticide spraying, hence government cooperation is required for allowing supporting legislative environment.

Advantages

The following are the key advantages of using drones for pesticide spraying:

• Improved agrochemical application efficiency and accuracy. Crop protection products (CPP) are not wasted as a result, which improves pest management and crop output.

• Considerable decrease in operator exposure risk during spray operations.

• Drone-assisted spraying has a field capacity that is nearly 20 times greater in comparison to manual spraying.

• Lower water consumption.

Insect collection is a source of recreation for many people and maybe a hobby for those who are interested in studying insects. Methods of collection and preservation of insects are the pre-requisite to studying the insects and their various internal and external organs. After collection, it becomes imperative to keep and preserve the insect specimens intact and safe for a longer time to further study the characters or to develop the insect collection museum. Let‘s have a look and do the different types methods of collection, and devices used for the collection and preservation of insects including immature stages in this practical session.

Collection

 The purposes of insect collection are:

To know the occurrence of a particular insect in a particular locality.

Taxonomic study of insects.

Identification of insects.

To study the bionomics and rearing of insects for various entomological experiments.

To develop the insect repository etc.

The grasshoppers are widely distributed throughout the country and may be seen in abundance during monsoon season. For the generalized morphological description, this insect has been considered as the most suitable representative of class insects because its structural details are not much variable. Apart from this, being larger, it can be studied easily. The generalized insect body is divided into 3 distinct body regions: a head, a thorax and an abdomen. Grouping of body segments into distinct regions is known as Tagmosis and the body regions are called Tagmata.

The Head

The collected insect samples can be inspected in the laboratory after detaching the antenna and putting them under the microscope. They can also be studied through the permanent slides of different types of antennae with the help of microscope.

Antennae are mobile sensory segmented appendages of the head. They articulate with head in front or between the eyes and arise from antennal socket. The size and shape of antennae varies in different insects. They are used for sensory perception which includes motion and orientation, odor, sound, humidity, and a variety of chemical cues. The Sensilla on the antenna acts as tactile, olfaction, carbon dioxide, temperature, wind, humidity, and sound receptors.

Structure of Antenna: Antennae consist of three parts

Mouthparts of insects vary among insects of different groups depending upon their feeding habits. They are mainly of two types viz., Mandibulate (feeding mainly on solid food) and haustellate (feeding mainly on liquid food). Insect mouthparts have become modified in various groups to perform the ingestion of different types of food and by different methods. Indeed the modifications in the mouthparts to ingest almost all kinds of the food material, are one of the factors for the success of the group.

1. Biting and chewing type: e.g. Cockroach & grasshopper.

The typical thoracic leg consists of six parts, basal coxa that articulates with the thorax in the pleural region, small trochanter, femur, tibia, segmented tarsus, and pre-tarsus. The coxa is often divided into two parts, the posterior and the anterior (usually the larger part) being called the meron. The trochanter articulates with the coxa but usually forms an immovable attachment with the femur. The femur and tibia are typically the longest leg segments. The tarsus, which is derived from a single segment, - is usually subdivided into individual tarsomeres. The pretarsus may consist of a single claw, but it is usually composed of a pair of moveable claws and one or more pads or bristles. Legs are usually looked upon as the principal organs of terrestrial locomotion.

The complete system of veins of a wing is termed venation or neuration. Generally in all the insects, there is some similarity in wing venation and therefore, it is presumed that all types of wing venation have developed from the common base or the same ancestor. Using an extensive study of wing venation in different groups of insects, Comstock and Needham constructed a hypothetical type of wing venation from which all other types have presumably been derived. According to them the primitive wing venation has developed from two tracheae which are situated on the anterior and the posterior basal margins of wings and their branches are spread all over the wing.

Metamorphosis and immature stages

The change in growth and development (form) of an insect during its life cycle from birth to maturity is called metamorphosis. There are four basic types of metamorphosis in insects.

Ametabola: (No metamorphosis) e.g. Silver fish.

These insects have only 3 stages in their life cycle namely egg, young ones and adults. It is most primitive type metamorphosis. The hatching insects resemble the adult in all respects except for the size and called as juveniles. Moulting continues throughout the life.

Hemi-metabola: (Incomplete metamorphosis) e.g. Dragonfly, damselfly and may fly.

These insects also have 3 stages in their life namely egg, young ones and adults. The young ones are aquatic and are called naiads. They are different from adults in habits and habitat. They breathe by means of tracheal gills. In dragonfly naiad, the lower lip (labium) is called mask which is hinged and provided with hooks for capturing prey. After final moult, the insects have fully developed wings suited for aerial life

The best learning situation requires one specimen and set of tools per two students for studies. Students working in pairs have ample opportunity to fully participate in the dissection and to carefully examine the specimen. They are also able to share and discuss their observations during and after the dissection.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Requirements: Dissecting pan with wax pad, dissecting pins, forceps, hand lenses and scissors

Procedure

Place the specimen in the dissecting pan ventral side up. Use scissors to cut through the exoskeleton‘s ventral side from the head to the posterior end of the abdomen.

Pull the cut sides apart and observe the internal organs. Pin the sides of the insect to the dissecting pan. The observation of the reproductive systems of males and females are as follows:

Female reproductive system

The main functions of the female reproductive system are egg production and storage of male spermatozoa until the eggs are ready to be fertilized. The basic components of the female system are paired ovaries, which empty their mature oocytes (eggs) via the calyces (Calyx) into the lateral oviduct which unite to form the common (median) oviduct.

Requirements: Agriculturally important insects of each order

 Orthoptera

 Examples: Grasshopper, cricket, etc.

Metamorphosis: Paurometabolous

Mouthparts: Chewing

 Significance: Variable or Pest

 Characteristics

 •            They are medium to large-sized insects.

 •            Antenna is filiform.

 •            Mouthparts are mandibulate.

 •            Prothorax is large. The pronotum is curved, ventrally covering the pleural region.

•             Hindlegs are saltatorial

 •            Forewings are leathery, thickened and known as tegmina.

 •            They are capable of bending without breaking.

 •            Hindwings are membranous with large anal area.

 •            They are folded by longitudinal pleats between veins and kept beneath the tegmina.

Requirements: Insecticides of different types

Insecticide chemicals in their “raw” or unformulated state are not usually suitable for pest control. These concentrated chemicals and active ingredients may not mix well with water, may be chemically unstable, and may be difficult to handle and transport. For these reasons, manufacturers add inert substances, such as clays and solvents, to improve application effectiveness, safety, handling, and storage. Inert ingredients do not possess Insecticidal activity and are added to serve as a carrier for the active ingredient. Manufacturers will list the percentage of inert ingredients in the formulation or designate them as “other ingredients” on their labels.

Sprayers

Sprayer is a machine used to apply liquid chemicals on plants to control pest and diseases. It can also be used to apply herbicides to control weeds and to spray micro nutrients to enhance plant growth. The main functions of a sprayer are

•             Breaking the chemical solution in to fine droplets of effective size.

 •            Distributing the droplets uniformly over the plants.

 •            Applying the chemicals with sufficient pressure for positive reaching the plants

 •            Regulating the amount of liquid applied on plants to avoid excessive application.

Requirements: Clipboard, Pencils, Hand lens, Pocket knife, insect catching nets, attractants, spread sheet Collection bags and vials, Camera etc.

Sampling techniques are used to draw valid inferences about the population parameters using the sample statistics

Components of an insect sampling program 

Knowledge of pest and beneficial insects

Identification

 Life cycle and biology

Injury caused

Sample: Sample is a subgroup of the population. It is defined as a collection of individual observations from the population about which inferences are to be made, and is obtained by a specific method.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Polymerase Chain Reaction (PCR) is a laboratory technique, developed by Kary Mullis in the 1980s, used in molecular biology to amplify and replicate a specific segment of the DNA (Mullis, 1990). This reaction in performed in a thermal cycler, involving three main steps: denaturation, annealing and extension.

Principle: PCR is based on the principle of selectively amplifying a specific region of DNA through a series of temperature-controlled cycles. The key components involved in PCR include the target DNA sequence, oligonucleotide primers, DNA polymerase enzyme (Taq DNA polymerase), deoxyribonucleotide triphosphate (dNTPs) (A, T, G, and C), Mg2+ and a thermal cycler apparatus. Initially, the double-stranded DNA is split into single strands under high temperature of 90-95 0C known as the denaturation step. It is followed by cooling the solution to a temperature that allows proper attachment of the oligonucleotide primers to its complementary sites in the strands, known as the annealing step.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface.

Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane.

1. Preparation of tissue homogenate

The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

1. Introduction

Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

A. Mixing and Homogenization

1. I.ntroduction to Mixing and Homogenization

In the food industry, mixing and homogenization are fundamental procedures that are essential to the production of a wide range of food items. To produce the desired qualities and final result with uniformity and consistency, various ingredients are blended. Ensuring product quality, stability, and customer happiness are contingent upon these processes.

Importance of Mixing and Homogenization

Mixing and homogenization are paramount for several reason

A. Novel Dehydration Technologies

Dehydration, the process of removing moisture from food products, is crucial for enhancing shelf life, reducing weight and volume for transportation, and preserving nutritional value. Traditional dehydration methods, such as sun drying, air drying, and freeze drying, have been widely used for centuries. However, advancements in food technology have led to the development of novel dehydration technologies that offer improved efficiency, quality retention, and sustainability.1. Vacuum Microwave Dehydration

Vacuum microwave dehydration is a cutting-edge dehydration technique that combines the advantages of removing moisture from food products while preserving their color, flavor, texture, and nutritional content (fig 1).

A. Non-thermal Processing

Non-thermal processing encompasses a diverse range of food preservation and treatment techniques that do not rely on heat as the primary means of achieving microbial inactivation or quality preservation. Unlike conventional thermal methods such as pasteurization and sterilization, which involve exposing food to elevated temperatures for a specified duration, non-thermal processing methods operate at or near ambient temperatures. These innovative technologies offer several advantages, including the preservation of sensory attributes, retention of nutritional quality, and minimization of detrimental effects on food texture and f lavour (fig 1).

Distillation, leaching, and extraction

A. Distillation

Distillation is a widely used separation process in various industries, including chemical, pharmaceutical and food processing. It is particularly important in the production of alcoholic beverages, essential oils, and purified water. Distillation works on the principle of exploiting differences in the volatility of components in a liquid mixture to separate them based on their boiling points.

Principles of Distillation

Distillation is a time-tested and versatile separation technique employed across a myriad of industries for separating components of liquid mixtures. Its effectiveness lies in its ability to leverage differences in boiling points among the various constituents of a mixture.

Food Plant Hygiene

A. I.mportance of Food Plant Hygiene:

1. Ensures the Safety and Quality of Food Products: Proper hygiene practices within food processing facilities play a critical role in safeguarding the safety and quality of food products. By adhering to stringent hygiene protocols, including thorough cleaning, sanitation, and preventive measures, facilities can effectively prevent the contamination of food products by harmful microorganisms, chemicals, or physical hazards. This helps minimize the risk of foodborne illnesses and ensures that consumers receive safe and wholesome food products. Additionally, maintaining cleanliness and hygiene in food proce

1.1 Introduction

In the contemporary context, women's empowerment in rural India holds immense significance. These women fulfil critical roles as farmers, wage earners, and entrepreneurs, all while managing family responsibilities such as providing food and caring for children and older people. Despite their vital contributions, rural women face entrenched challenges, including gender based discrimination, societal norms, and unequal access to education, healthcare, property, and financial services. The burden of unpaid work, particularly prevalent in economically disadvantaged households, further compounds these obstacles. Notably, women from indigenous and grassroots communities contribute significantly to their communities’ livelihoods and serve as custodians of traditional knowledge essential for cultural preservation.

1.1 Introduction Rural women worldwide grapple with many challenges, ranging from restricted access to essential resources and limited educational opportunities to constrained pathways for economic advancement. Extensive research conducted by the World Bank has illuminated the persistent struggles faced by rural women, emphasizing disparities in education, healthcare, and economic opportunities (World Bank, 2019). Simultaneously, UN Women underscores the systemic hurdles perpetuating gender inequalities, necessitating urgent and comprehensive solutions (UN Women, 2020).

Amidst these challenges, emerging technologies stand as a transformative force with the potential to reshape the trajectories of rural women. Recognizing this potential, the International Telecommunication Union (ITU) emphasizes the capacity of technological interventions to ameliorate challenges faced by women in rural areas.

3.1 Introduction

Women are the backbone of the family. God gave her all the power to give birth, raise the children, do all the household chores, and balance the professional work. But we forget that women are also human beings, not machines. They can’t work 24x7 they also need rest as well as proper nutrition. Women in ancient India were very powerful in terms of decision-making, political opinion, education, etc, but later on, the situation of women deteriorated. In the middle era, the situation was at its worst: women were being treated badly by the men in their own families. Currently, the situation is turning better. Women are being treated equally now times but it is not the best scenario we can have. There is still much scope in this field where equal wedges and a good environment can be provided to the women.

4.1 Indian Rural Women Embracing the Changes

Rural areas are chiefly characterized by a strong reliance on primary industries such as agriculture, forestry, fishing, and mining (MacTavish, 2020). When examined by occupation, the agricultural sector frequently acts as the foundation of rural economies, employing a sizable percentage of workers in farming, livestock raising, and crop production (Cagliarini & Rush, 2011). Unlike urban areas, rural regions offer fewer non-agricultural employment opportunities, leading to a greater emphasis on self-employment, small-scale enterprises, and seasonal work patterns. Limited access to formal employment prompts reliance on informal sectors such as casual labour and subsistence farming.

5.1 Introduction

“Women give life and play a vital role in safeguarding the ecosystem. Technology is the Plow that furrows the soil of justice, enabling women farmers to plant the crops of sustainable development.”

Women are half the people in the world, and they have done better than men in many ways in the last 30 years. But they still face more problems than men, because they do not have the same access to things like money, land, and power. Gender equality is not only a good thing by itself but also good for the economy, society, and the environment. If women and men have the same chances to do things and make decisions, we can have a better way of development that considers the needs of both women and men.

6.1 Introduction

In its broadest sense, literacy stands as a fundamental pillar of youth development, transcending mere reading and writing abilities to encompass critical skills necessary for navigating today's complex world (UNESCO, 2020). Concurrently, connectivity serves as the backbone of digital transformation, facilitating communication, collaboration, and access to information on a global scale (ITU, 2021). Skill development, particularly in digital literacy, has become indispensable in an increasingly digitized society, empowering individuals to thrive in both personal and professional domains (European Commission, 2019).

7.1 Introduction

The evolution of the digital landscape has been nothing short of revolutionary, shaping the way we live, work, and interact with one another. Since the inception of the ARPANET military experiment in 1968, which laid the groundwork for the internet as we know it today, the world's digitization has been accelerating at an unprecedented pace. What started as a military endeavor has evolved into a global network connecting billions of people across geographical boundaries, giving rise to virtual communities, and fundamentally transforming the way information is accessed and disseminated. As we navigate through this digital age, characterized by rapid technological advancements and an ever expanding digital ecosystem, the role of individuals in this landscape has evolved significantly.