eChapters

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Previous Year Questions

1. What is DNA fingerprinting? Discuss the applied aspects in modern agriculture. (15M, CSE 2021)

• The term DNA fingerprinting in its original sense refers to the method developed in 1985 by Sir Alec Jeffreys (Jeffreys et al., 1985) and his associates for the simultaneous detection of highly variable DNA fragments by hybridisation of specific multilocus probes to electrophoretically separated restriction fragments?

• The DNA fingerprints, resembling barcodes, are unique to the individual and hence can be used in much the same way as conventional fingerprints - to identify individuals with absolute certainty?

DNA Fingerprinting Techniques

• A large number of fingerprinting techniques are in currency, which are variations and combinations of restriction fragmentation and polymerase chain reaction (PCR).

• Restriction fragment length polymorphism (RFLP) involves digesting DNA with restriction enzymes, separating the resultant DNA fragments by gel electrophoresis, blotting the fragments to a filter and hybridising probes to the separated fragments. Specific probe-enzyme combinations give highly reproducible patterns.

• With the advent of PCR technology a number of simpler techniques have become available for molecular characterisation.

• These include, random amplified polymorphic DNA (RAPD) and its several variants, intersimple sequence repeats (ISSR), amplified fragment length polymorphism (AFLP) and sequence tagged microsatellites sites (STMS).

Introduction
Rice is a key crop that directly feeds about half of the global population, with most of it consumed in developing countries (Wang et al., 2018). It is cultivated in many different types of environments and is always being enhanced by the creation of new varieties and the assessment and conservation of germplasm collections. To improve rice diversity and increase its genetic range, numerous researchers and organizations have been attempting to bring long-forgotten types back into production.This variation among varieties is essential for breeders as it provides genetic traits that can be incorporated into commercial varieties, such as resistance to diseases and pests, tolerance to abiotic stresses and improvements in grain nutritional quality, among others. In some cases, specific new traits areintroduced through crosses made with distantly-related genotypes. As a result of these efforts, despite being one of the first domesticated crops, cultivated rice continues to tap into a vast gene pool (Vieira et al., 2022).
There are over 500,000 rice accessions stored in gene banks around the world (Genesys 2021). To further explore the molecular diversity of this germplasm International Rice Research Institute (IRRI), Chinese Academy of Agricultural Sciences and BGI-Shenzheninitiated the 3K Rice Genome Project. This project focused on the most important rice species, Oryza sativa, and involved resequencing 3,000 rice genomes selected from the available genetic diversity, creating an invaluable resource for large-scale genetic variation discovery in this species (Vieira et al., 2022).
Varietal identification and classification in breeding programs are typically assessed using the distinctness, uniformity, and stability (DUS) approach, which relies on morphological descriptors (Tiwari et al., 2013). However, using morphological data/markers to determine genetic variation has limitations due to the labor-intensive, time-consuming nature of the process, as well as theagronomical traits and season-specific that are heavily influenced by ecologicalaspects. The development of genetically and morphologically similar varieties has made the task of clearly distinguishing between them increasingly complex. These environmental challenges necessitate the use of new techniques that are fast, reliable and environmentally independent.Biochemical and chemical tests fail to accurately estimate genetic distances among closely related genotypes. PCRbased molecular markers, however, are fast, reliable, and effective for determining the genetic purity of crop varieties (Rana, 2006). Hypervariable microsatellites (Teymnykhet al., 2011) offer a valuable source of polymorphic DNA markers, connecting genetic maps to genomic sequences and, ultimately, to phenotypic variation. SSR-based “DNA barcodes” are unique patterns of SSR polymorphism that assist in the precise identification of varieties, providing stability and resistance to environmental influences, epistatic interactions, and pleiotropic effects.

Introduction
Plant genetic resources (PGRS) encompasses everything that is on the earth related to the plants which are beneficial to mankind (Appazov,2008). So, it is the basic raw material for crop improvement (Somsenet al., 2002). In the present regime of transgenic crops, you can have ‘designer crops’- crops of your willingness (Wisner et al., 2001). From the heritage of mankind to the sovereign rights of the states this is the path that PGRs have traversed, earlier before CBD (Conventional Biological Diversity)(Chakraborty et al., 2018) PGRs were considered as a heritage of mankind freely available to everybody but after signing that they became the sovereign rights of the states with sovereign rights of the nation (Brahmiet al., 2015). In such a scenario where states have their rights on those plants’ genetic wealth, protection becomes very important (Clevelandet al., 1997). DNA fingerprinting is one of the technologies which can facilitate that protection (Wanget al., 2019).Rapeseed-mustard (Brassica spp.) is a vital oilseed crop cultivated extensively in India and other parts of the world (Kumaret al., 2008). It plays a crucial role in ensuring edible oil security and contributes significantly to the agricultural economy(Pahariyaet al., 2007). The genetic diversity within rapeseed-mustard species is a key factor in improving yield potential, disease resistance, and oil quality through breeding programs (Chandet al., 2021). However, accurately identifying and characterizing varieties is a challenge due to phenotypic similarities, environmental influences, and potential genetic erosion(Chhikaraet al., 2024). To address these challenges, DNA fingerprinting has emerged as a powerful molecular tool for precise varietal identification, genetic purity assessment, and germplasm conservation (Hosseinpouret al., 2024).DNA fingerprinting involves the use of molecular markers to generate unique genetic profiles of plant varieties, enabling breeders and researchers to differentiate between closely related cultivars (Singhet al., 2022; Singhet al., 2014). This technology is instrumental in breeding programs, ensuring the registration and protection of plant varieties under legal frameworks such as the Protection of Plant Varieties and Farmers’ Rights Act (PPV&FRA) in India (Williamet al., 2024). Additionally, DNA-based markers provide valuable insights into genetic relationships, aiding in the efficient selection of parent lines for hybridization and improving crop resilience to biotic and abiotic stresses (Nadeemet al., 2018; Haqueetal., 2021).Over the past two decades, several DNA fingerprinting techniques, including Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Simple Sequence Repeats (SSR), and Single Nucleotide Polymorphisms (SNPs), have been widely applied to characterize rapeseed-mustard varieties (Nybomet al., 2014; Panjabietal.,2019) Advances in high-throughput genotyping and nextgeneration sequencing (NGS) technologies have further enhanced the resolution and accuracy of genetic profiling, paving the way for marker-assisted selection (MAS) and genomic-assisted breeding strategies (Sinhaet al., 2023).

ABSTRACT

DNA fingerprinting is increasingly being used for identification of varieties, quantification of similarity between varieties and study of genetic diversity available in the population.

This is all the more important in crops where morphological variability is less or one variety is known by different names or different varieties are known by same name.

DNA fingerprinting using RAPD method has been standardized for tapioca. Dellaporta method has been used for extraction of DNA and amplification was done following William’s method. This technique has been used for molecular characterisation of accessions and identification of duplicates in the germplasm maintained at Central Tuber Crops Research Institute, Thiruvananthapuram. This technology has been extended for DNA fingerprinting of released varieties and also some of the elite breeding lines.

Eleven varieties released from the institute were fingerprinted using a few primers, which showed high polymorphism in tapioca. One single primer gave distinct banding pattern for all the 11 varieties and it was capable of earmarking each variety.

Individual variety was finger printed for 20 different primers and the results were documented. This technique is being extended to promising land races as well. DNA fingerprinting will be useful for protecting Plant Breeders’ Right as well as Farmers’ Right in the new Patent Regime.

Introduction
DNA fingerprinting envisages a very significant molecular methodology employed for identification and characterization of wheat varieties and germplasm. It is of utmost importance in varietal authentication, rights protection of breeders, and analysis of genetic diversity. Currently employed molecular markers like SSRs, SNPs, and DArT are applied extensively for wheat fingerprinting. Such markers precisely differentiate closely related varieties and aid in breeding programs (Babu et al., 2020; Kiss et al., 2021).
The current standing of wheat DNA fingerprinting shows a trend toward high-throughput genotyping and genomic selection strategies to accelerate crop improvement. Future prospects would entail the integration of advanced sequencing technologies such as Next-Generation Sequencing (NGS) and machine learning for genetic analysis. These technologies will ease wheat breeding and dramatically contribute to food security and climate-resilient agriculture. Expanding the global DNA fingerprinting database would further enhance global wheat germplasm conservation and utilization (Sandhu et al., 2021; Ahmadi et al., 2020). Wheat (Triticum spp.) is one of the major staple crops of the world, supporting the sustenance of over one-third of the total world population. It is the main source of carbohydrates, proteins, fibers, and other important micronutrients, making it very important for human nutrition. Wheat is cultivated mainly in all types of agro-climatic zones, with major producers being China, India, Russia, United States, and the European Union.
Wheat is highly valuable not only in terms of food security, but also economically with millions of farmers involved in its production and trading worldwide. Wheat is an important raw material for many food products, such as bread, pasta, and baked goods. Wheat production faces challenges from climate change, pests, and emerging pathogens. Therefore, continuous research on wheat, genetic improvement for desirable traits, and sustainable agricultural practices are needed to enhance yield, resilience, and in turn global food security. Genetic diversity in wheat is pertinent for fulfilling food security at the global level and for the success of breeding programs, apart from giving diverse traits for resistance against pests, diseases, and environmental stresses like droughts

Apoptosis is triggered by extrinsic and intrinsic stimuli as radiation, oxidative stress and genotoxic chemicals. It is defined by characteristic changes in the nucleus morphology including chromatin condensation and fragmentation, overall cell shrinkage/rounding and formation of apoptotic cell bodies. Among the many markers of apoptosis, DNA fragmentation is considered a hallmark. The DNA ladder assay described here is a simple, sensitive, cost-effective and rapid method for estimating apoptosis in cells.

Isolation of Genomic DNA

Genomic DNA from primary cells culture of PMNC and splenocytes of rats is isolated by using standard phenol-chloroform DNA isolation protocol of Sambrook and Russel (2001) as described below:

1. Preparation of primary cells culture of different cells, namely-PBMNCs, thymocytes and splenocytes form Wistar rats and viability checked by trypan blue dye exclusion test.

2. 106 cells/ml of primary cell culture is used and seeded in 24 well culture plates containing along with treatment with xenobiotics at different µM concentration.

3. Cell culture plates are incubated in CO2 incubator at 37°C with 5% CO2 for 12 hrs.

4. The cells are collected in 1.5 ml of micro centrifuge tube and centrifuged at 3200 rpm for 10 min at 4°C; supernatant is discarded and pellet is washed with PBS (pH 7.2).

5. DNA extraction buffer (500 µl/tube) is added in tubes. Gently tap to disperse the cell pellet in extraction buffer and keep in water bath for 1.0 hr at 37 °C (it is to ensure that pellet is completely suspended so that cells are accessible to SDS and Proteinase K).

6. 10 % SDS is added (20 µl/ml) to cell suspension and the tubes are gently mixed by inverting the tube. The contents of tube become viscous which indicates lysis of cells. After that sample is handled gently from onward to avoid shearing of DNA.

7. Proteinase K (15 µl) of 20 mg Proteinase K/ml of buffer is added in tubes in two pulse i.e. half the requirement is added to tube in 1st pulse, mixed gently end to end and kept in water bath at 50°C. After 3-4 hrs, the second pulse of the remaining amount of Proteinase K is added and tubes are incubated at 50°C overnight.

8. Equal volume of equilibrated phenol (Tris saturated phenol pH> 7.8 ) is added in the tubes next day morning. Mix the contents of tube gently by inverting the tube for 15 min till a light coffee coloured uniform solution without any balls of phenol is formed and then centrifuge at 3400 rpm for 15 min.

Objective: To isolate DNA from plant sample by CTAB method and quantification by spectrophotometer.

Background information:

DNA isolation from different plant tissues viz., leaf, stem, root, flower and seed is a challenging task due to hindrance of variety of variety of biochemical compounds present and further problem increases with diverge plant species. In case of animal tissues the diversity in cellular bio-molecules in different species is much lower compared to plants. Two major phyto bio-molecules that have wide variation between species and pose serious problems in DNA isolation are: polyphenols and polysaccharides. These phyto bio-molecules if contaminated in DNA then may hinder further down applications like PCR, restriction digestion, sequencing, etc.

Several methods have been developed and reported that can remove polyphenols and polysaccharides efficiently during DNA isolation from plants. For this purpose two different chemicals are widely used,the first one is CTAB (cetyl trimethyl ammonium bromide) that is a cationic detergent and helps in removal of polysaccharides and the second one is polyvinylpyrrolidone that helps in removal of polyphenols. Due to above properties the CTAB based DNA extraction buffer is very common for plant DNA extraction.

Significance of different types of chemicals found in CTAB based plant DNA extraction method is explained as under:

Principle

The rate of joining of DNA fragments is affected by seven parameters:

DNA concentration,

Concentration of compatible ends,

Size of the fragments,

Presence or absence of complementary, single-stranded ends (some nucleases form blunt ends and in these cases special techniques are needed for joining),

G + C content and length of the complementary single strands,

Temperature of the reaction and

Ionic composition of the solution.

ABSTRACT

The process of developing new crop varieties involves many steps and takes several years. In recent times, biotechnological advances have helped in reducing these considerably. Apart from the techniques of haploid culture and genetic engineering, one of the tools which is making it easier for scientists to select plant traits and develop new varieties is the use of molecular markers. Molecular markers can be used for (a) characterization of germplasm (b) varietal identification and clonal fidelity testing (c) assessment of genetic diversity (d) validation of genetic relationships and (e) marker- assisted selection. These have widespread applications in management of genetic resources as well as in breeding programmes. Marker-assisted selection has practically revolutionized breeding programmes. Traditionally, plant breeders have selected plants based on their visible or measurable traits called the phenotype. But this process can be difficult especially in the case of multigenic or quantitative traits. Molecular markers can be used to trace linkages with traits of importance. In the area of horticulture, this is a very useful tool in tree breeding, where the breeder has to wait for several years for phenotypic expression of the desired trait. A number of DNA marker technologies are now available and rapid advances are being made in the development of more sensitive marker technologies. The techniques involved, the various applications of DNA marker technologies in horticultural crops and future perspectives in the national context have been discussed.

Introduction

DNA denaturation, also called DNA melting, is the process by which double-stranded deoxyribonucleic acid unwinds and separates into single-stranded strands during the breaking of hydrogen bonding between the bases. Both terms are used to refer to the process as it occurs when a mixture is heated, although “denaturation” can also refer to the separation of DNA strands induced by chemicals like urea. For multiple copies of DNA molecules, the melting temperature (T_m) is defined as the temperature at which half of the DNA strands are in the double-helical state and half are in the “random-coil” states. The melting temperature depends on both the length of the molecule, and the specific nucleotide sequence composition of that molecule.

Applications of DNA Denaturation

The process of DNA denaturation can be used to analyze some aspects of DNA. Because cytosine / guanine base-pairing is generally stronger than adenosine / thymine base-pairing, the amount of cytosine and guanine in a genome (called the “GC content”) can be estimated by measuring the temperature at which the genomic DNA melts. Elevated temperatures are associated with high GC content. GC ratios within a genome are found to be markedly variable. These variations in GC ratio within a genome of higher organisms results in a mosaic like formation with islet regions called isochores. This results in the variations in staining intensity in the chromosomes. The isochores include in them essential protein coding genes, termed housekeeping genes and thus determination of ratio of these specific regions contributes in mapping these essential genesbacterial systematics has recommended use of GC ratios in higher level hierarchical classification. For example, the Actinobacteria are characterised as “high GC-content bacteria”. In Streptomyces coelicolor A3(2), GC content is 72%. The GC-content of Yeast (Saccharomyces cerevisiae) is 38%, and that of another common model organism Thale Cress is 36%. Because of the nature of the genetic code, it is virtually impossible for an organism to have a genome with a GC-content approaching either 0% or 100%. A species with an extremely low GC-content is Plasmodium falciparum (GC% = ~20%), and it is usually common to refer to such examples as being AT-rich instead of GC-poor.

Preparation of Solutions

GTE buffer

50 mM Glucose,

25 mM Tris-Cl,

10 mM EDTA,

pH 8

NaOH/SDS lysis solution

0.2 M NaOH,

1% SDS

Reagents

EDTA

Ethanol, absolute

Isopropanol

Phosphate Buffered Saline (PBS), 1X

Proteinase K

Sodium Acetate, 3 M pH 5.2 (Molecular Biology Grade)

Sodium chloride (NaCl)

Sodium Dodecyl Sulfate (SDS ), 10%

Tris EDTA (TE), pH 7.4

Tris EDTA (TE), pH 8.0

Tris HCl, pH 8.0

Reagents

Chloroform

EDTA, 0.5 M

Ethanol, absolute

Isoamyl alcohol

Phenol

Phosphate Buffered Saline (PBS), 1X

Proteinase K

RNAse A

Sodium dodecyl sulfate (SDS) solution, 10%

Reagents

Chloroform

EDTA, 0.5 M

Ethanol, absolute

Is amyl alcohol

Phenol

Proteinase K

RNase A

Sodium acetate, pH 5.2

Sodium chloride, 5 M
Sodium thiocyanate (NaSCN), 1 M

TE Buffer (Tris-EDTA), pH 7.4

Tween 20

Xylene

DNA replication. The double helix is unwound and each strand acts as a template. Bases are matched to synthesize the new partner strands.

DNA replication, the basis for biological inheritance, is a fundamental process occurring in all living organisms to copy their DNA. This process is “replication” in that each strand of the original double-stranded DNA molecule serves as template for the reproduction of the complementary strand. Therefore, following DNA replication, two identical DNA molecules have been produced from a single double-stranded DNA molecule. Cellular proofreading and error toe-checking mechanisms ensure near perfect fidelity for DNA replication.

In a cell, DNA replication begins at specific locations in the genome, called “origins”.

Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork. In addition to DNA polymerase, the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other proteins are associated with the fork and assist in the initiation and continuation of DNA synthesis.

Watson and Crick based on their double helical DNA model, offered to explain DNA replication by a method where each single strand of DNA is template or mold for its complement and a new helix has one old strand and one newly synthesized strand. This type of DNA replication is called as semi-conservative as in this method one old strand is retained and one new complementary strand is synthesized. In contrast to semi-conservative mode of DNA replication, two more modes of DNA replication were proposed. One is conservative type where two new strands are synthesized in form of a double helix while the old double helix remains unchanged. The third type of DNA replication proposed has been dispersive mode of DNA replication which amounts to breaking down of double helical strands into small pieces along the length, their replication and random assemblage with newly synthesized pieces to form a patchwork single string of dispersed old and new pieces. These three modes of replication of DNA molecule are shown in Fig. 40.1.

7.1 Basic concept

What is DNA sequencing?

The genome of any biological organism is a sequence of nucleotides arranged in a specific manner. The nucleotides are chemically a base which usually exists in 4 different forms; Purine – Adenine (A) and Guanine (G) and Pyramidine – Cytosine (C) and Thymine (T). These four nucleotides make up an entire sequence of Deoxyribose Nucleic Acid (DNA) which is encodes the information of any cell in the form of a gene. The genome, therefore, is the complete set of all genes that is required to build and maintain that organism. DNA sequencing is the process wherein the precise order of these nucleotides along the gene is detected and analysed which includes any method or technology that assists in determining the sequence.